Clone FMO10188 Report

Search the DGRC for FMO10188

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:88
Vector:pMK33-CFH-BD
Associated Gene/TranscriptOs-C-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10188.5prime Sequence

431 bp (431 high quality bases) assembled on 2010-11-05

> FMO10188.5prime
CAGTCGACATGGGTTTTCACATGGGACGACAGCTGCTACTCTCCGGATTC
CTGCTGGTGATGCTTCAGATGGTGACCCAAACGCAGGCCAGGCCGCAGGA
TGTGATCACAGTTGCTGGCGAGGAGACAGAGGTGGTGATCAAGCGGGAGG
GCGATGACGATGGAGACGACGATGACTCCTCCTCCGAGGAAACAGTCGAG
GATTCCGAGGAAAGCAGACGCAGACGACGCGAGGTGAATACGGACAACAC
GCCATCGGCTCGAGCGGTTATTCCAGGCGAGCAAGTAGTCCCCATTCTCT
TGGAGGCCATTCTTCCCAGCGTGGATGCAGCGGGCGATCGCTTCGCAAGA
TCTGTGCAATTTCTGAAAAACTTGACCCCTGGCTCTGAATTGTTTGCCGT
CGAGAAGAACGAAGCAAGCTTTCTAGACCAT

FMO10188.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:55:14
Subject Length Description Subject Range Query Range Score Percent Strand
Os-C-RC 550 CG3250-RC 17..421 9..413 2025 100 Plus
Os-C-RD 538 CG3250-RD 17..409 9..413 1835 97 Plus
Os-C-RB 604 CG3250-RB 17..285 9..277 1345 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:55:12
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 7979114..7979295 96..277 910 100 Plus
3R 32079331 3R 7979347..7979485 275..413 695 100 Plus
3R 32079331 3R 7978975..7979065 9..99 455 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:55:13 has no hits.

FMO10188.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:15 Download gff for FMO10188.5prime
Subject Subject Range Query Range Percent Splice Strand
Os-C-RC 17..425 9..419 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:33 Download gff for FMO10188.5prime
Subject Subject Range Query Range Percent Splice Strand
Os-C-RC 17..425 9..419 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:49 Download gff for FMO10188.5prime
Subject Subject Range Query Range Percent Splice Strand
Os-C-RC 17..425 9..419 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:49 Download gff for FMO10188.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 7979349..7979489 277..419 97   Plus
3R 7979117..7979294 99..276 100 -> Plus
3R 7978975..7979064 9..98 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:33 Download gff for FMO10188.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 3805071..3805211 277..419 97   Plus
arm_3R 3804839..3805016 99..276 100 -> Plus
arm_3R 3804697..3804786 9..98 100 -> Plus