Clone FMO10189 Report

Search the DGRC for FMO10189

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:89
Vector:pMK33-CFH-BD
Associated Gene/TranscriptSfp23F-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10189.5prime Sequence

260 bp (260 high quality bases) assembled on 2010-11-05

> FMO10189.5prime
CAGTCGACATGCGTTTATATAAAATATTCTGCCTAATTTGTTCCATATTT
GGCTGTGTTTCAGCTTTAAAAGATCCGAGCTGTGCTGTTGAGTTGTTTGG
CCAAGGTGCTTGCAACACTTTGATTACTCGAATCGGCTATTTACGTTGGG
AAAACATGTGTACATCAAAGAACTTTGTTGCATGCGACACCGATGGAACT
TCATTTGAGAGCATTAAGGAATGCGAAGATAAATGCAAAGAGGCAAGCTT
TCTAGACCAT

FMO10189.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:55:18
Subject Length Description Subject Range Query Range Score Percent Strand
Sfp23F-RA 322 CG42459-RA 36..269 9..242 1155 99.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:55:16
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 3387407..3387573 242..76 835 100 Minus
2L 23513712 2L 3387642..3387708 75..9 320 98.5 Minus
Blast to na_te.dros performed on 2014-11-26 16:55:17 has no hits.

FMO10189.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:15 Download gff for FMO10189.5prime
Subject Subject Range Query Range Percent Splice Strand
Sfp23F-RA 36..276 9..250 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:35 Download gff for FMO10189.5prime
Subject Subject Range Query Range Percent Splice Strand
Sfp23F-RA 36..276 9..250 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:51 Download gff for FMO10189.5prime
Subject Subject Range Query Range Percent Splice Strand
Sfp23F-RA 36..276 9..250 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:51 Download gff for FMO10189.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 3387642..3387708 9..75 98   Minus
2L 3387400..3387573 76..250 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:35 Download gff for FMO10189.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 3387642..3387708 9..75 98   Minus
arm_2L 3387400..3387573 76..250 97 <- Minus