Clone FMO10192 Report

Search the DGRC for FMO10192

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:92
Vector:pMK33-CFH-BD
Associated Gene/Transcript
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10192.5prime Sequence

746 bp (746 high quality bases) assembled on 2010-11-05

> FMO10192.5prime
CAGTCGACATGCTATCGCTGCTAGACCAGCCGTCCGCATCGCGAGGGTGG
GATTCAACCATGTCAAAGCCAGCTCTGTATTATGCCACCCTAAGTCCCCC
ATCGCGCGCCGTCCTCCTCACGGCTAAGGCGATCGGACTCGACCTTGAAC
TACGGCCAATTAACCTGCTGAAGGGAGAGCATCTGACTCCGGAATTCCTC
AAGCTGAACCCCCAGCACACCATCCCGACCCTGATCGACGGCGAGGCCAC
TATCATTGACTCGCACGCCATCTGCGCCTACCTGGTGGAGAAGTATGGCC
AGAAGGAGCAGCAGCTCTATCCGAAGGAATTGGTGCAGCGCGCCAACGTG
GATGCTCGGCTCCATCTGGACTCCGGCCACCTCTTCGCGCGCCTGCGCTT
CCTTTACGAGCCCATCCTGTATTATGGATCGACGGACTGCTCCATCGACA
AGATCGCATACATCCAGAAGTGCTGGGAGATCCTAGAGGGATTCCTCAAG
GATCAGCCGTATTTGTGTGGTTCTGATCTAACCATCGCAGACTTTTGCGC
CGTGGCCACCGTAACCTCGGTGAACGACACCGCTCCCATCGATGAATTTA
AGTTTCCCAAGATGCACGCCTGGCTGAAGCGTCTGGCAGAGCTACCCTAC
TACCAGGAGGTAAACGGCGACGGCGCTGACGAGCTTAAGAGCATCTTCAA
GGCCAAGCTGGCAGAAAACCGTGGCAAGGCAAGCTTTCTAGACCAT

FMO10192.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:55:24
Subject Length Description Subject Range Query Range Score Percent Strand
GstE12-RC 1311 CG16936-RC 492..1211 9..728 3600 100 Plus
GstE12-RD 907 CG16936-RD 130..807 51..728 3390 100 Plus
GstE12-RB 1022 CG16936-RB 220..896 52..728 3385 100 Plus
GstE12-RD 907 CG16936-RD 27..69 9..51 215 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:55:22
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 24766844..24767418 728..154 2875 100 Minus
2R 25286936 2R 24767474..24767578 155..51 525 100 Minus
2R 25286936 2R 24767639..24767681 51..9 215 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:55:22 has no hits.

FMO10192.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:16 Download gff for FMO10192.5prime
Subject Subject Range Query Range Percent Splice Strand
CG16936-RA 56..737 52..734 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:38 Download gff for FMO10192.5prime
Subject Subject Range Query Range Percent Splice Strand
GstE12-RC 489..1218 1..734 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:55 Download gff for FMO10192.5prime
Subject Subject Range Query Range Percent Splice Strand
GstE12-RC 487..1216 1..734 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:55 Download gff for FMO10192.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 24767639..24767686 1..51 92   Minus
2R 24767475..24767577 52..154 100 <- Minus
2R 24766839..24767417 155..734 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:38 Download gff for FMO10192.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 20655162..20655209 1..51 92   Minus
arm_2R 20654998..20655100 52..154 100 <- Minus
arm_2R 20654362..20654940 155..734 99 <- Minus