Clone FMO10193 Report

Search the DGRC for FMO10193

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:93
Vector:pMK33-CFH-BD
Associated Gene/TranscriptOgg1-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10193.5prime Sequence

1035 bp (1033 high quality bases) assembled on 2010-11-05

> FMO10193.5prime
CAGTCGACATGCTGGCTCATAACCTAGGTTTCCATAAAAAGCGCCTTTTT
TCAAACATGAAGGCTGTTTTACAGGATCGGGGTGTCATAGGCTTATCCCT
CGAAGAATGCGATTTGGAAAGAACTTTGCTTGGAGGACAGAGTTTCCGAT
GGCGATCCATATGCGATGGTAATAGAACGAAATATGGCGGAGTGGTGTTC
AACACCTACTGGGTGCTCCAGCAAGAAGAATCCTTCATAACTTACGAGGC
ATACGGAACCAGCAGTCCTTTGGCCACGAAGGACTATTCTTCCTTGATAT
CTGACTACCTACGTGTTGATTTCGACCTAAAGGTCAACCAAAAAGATTGG
TTAAGCAAAGATGATAACTTTGTGAAGTTCTTGAGTAAGCCTGTGCGCCT
CCTTTCTCAGGAGCCGTTCGAAAACATTTTTAGCTTCCTTTGCAGTCAGA
ACAATAACATCAAGCGCATATCATCTATGATTGAATGGTTTTGCGCTACA
TTTGGCACCAAGATTGGTCACTTCAATGGTGCCGATGCGTATACATTTCC
CACGATAAATAGATTCCACGACATCCCATGCGAGGATCTTAATGCCCAGC
TAAGGGCTGCCAAGTTCGGTTATCGGGCCAAGTTCATAGCACAAACGCTG
CAAGAGATCCAGAAAAAGGGGGGACAAAACTGGTTCATAAGCCTAAAGAG
CATGCCGTTCGAAAAAGCTCGCGAGGAGCTGACACTGCTACCCGGAATCG
GATACAAAGTGGCCGATTGCATCTGCCTTATGTCAATGGGTCACTTGGAG
TCAGTGCCCGTCGACATTCATATTTACAGAATTGCCCAAAATTACTACCT
GCCACATCTACCGGCCAAAGACGTAACCAAGAGATTTACGAGAGGTCTCG
AAACATTTTCAAAGCTACACGGAAGTATGCGGTTGGGCTCAGCTATTCTC
TTTTCTGCCGATTTGAGTCAATTCAAATACTTCCACAGTTGCTTGTAGAA
AATCATAAAACTAAAAGGCCAGCTTTCTAGACCAT

FMO10193.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:55:27
Subject Length Description Subject Range Query Range Score Percent Strand
Ogg1-RA 1307 CG1795-RA 162..1167 9..1002 4730 98.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:55:25
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 8691064..8691528 466..924 2045 98.5 Plus
X 23542271 X 8690685..8691003 148..466 1595 100 Plus
X 23542271 X 8690488..8690627 9..148 700 100 Plus
X 23542271 X 8691611..8691665 945..997 195 94.5 Plus
Blast to na_te.dros performed on 2014-11-26 16:55:26 has no hits.

FMO10193.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:17 Download gff for FMO10193.5prime
Subject Subject Range Query Range Percent Splice Strand
Ogg1-RA 157..1172 5..1010 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:40 Download gff for FMO10193.5prime
Subject Subject Range Query Range Percent Splice Strand
Ogg1-RA 159..1174 5..1010 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:58 Download gff for FMO10193.5prime
Subject Subject Range Query Range Percent Splice Strand
Ogg1-RA 159..1174 5..1010 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:58 Download gff for FMO10193.5prime
Subject Subject Range Query Range Percent Splice Strand
X 8691065..8691551 467..944 98 -> Plus
X 8690686..8691003 149..466 100 -> Plus
X 8690485..8690627 5..148 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:40 Download gff for FMO10193.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 8585098..8585584 467..944 98 -> Plus
arm_X 8584719..8585036 149..466 100 -> Plus
arm_X 8584518..8584660 5..148 98 -> Plus