Clone FMO10195 Report

Search the DGRC for FMO10195

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:95
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG5001-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10195.5prime Sequence

1123 bp (1030 high quality bases) assembled on 2010-11-05

> FMO10195.5prime
CAGTCGACATGGGTAAGGACTACTACAAAATCCTGGGTCTGCCCAAAACT
GCCACCGACGATGAGATCAAAAAGGCCTACAGGAAACTGGCCCTGCGTTA
TCATCCGGACAAAAACAAAGCCGCCAACGCCGAGGACAAGTTCAAGGAGG
TCGCCGAGGCGTACGAGGTTCTTTCGGACAAGAGCAAGCGGGAGGTGTAC
GACAAATACGGCGAGGATGGTCTCAAGAGCGGAGGCACACGAAACGGCGG
TCCGTCGAGCAACTCGTTTACATATCAGTTCCACGGCGATCCGCGGGCCA
CCTTCGCCCAGTTCTTTGGCAACAGCAATCCGTTCGCCTCGTTCTTCGAC
ATGGGCGACAACCTGTTCGACAAGAAGGTCTTCGATCTGGACACGGAACC
CGATTTCTTCTCCTCGCCCTTTGGCGGCATTGGGTCGCGACATGGTCTGG
GAAGTGGCTTCAGGCCCTCTTTCAGATCACACTCCTTCAATGTGCACACG
CCGTTCAAGAAGGAGCAGAAGCAGGATCCGCCCGTCGAACACGATCTCTA
TGTGACGCTGGAGGAGATCTACCACGGCTGTGTTAAGAAAATGAAAATCT
CCCGGCGCATCGTTCAGGCGGACGGCAGTTCCCGCAAGGAGGAGAAGTTC
CTGGCGATATCCATCAAGCCCGGCTGGAAGTCCGGCACCAAGGTCACCTT
CCAGAAGGAGGGCGACCAGGCGCCCGGAAAAATTCCCGCCGACATTGTGT
TCATCATCCGGGACAAGCCGCACGCCATGTTCAAGCGCGAGGGCAGCGAT
CTGCGCTACACGGCGAGACTGACGCTCAAGCAGGCTTTGTGCGGCGTTGT
CTTCCCAGTTTCCTACCATGTCCGGCGACAAGTTGCGCATCAGCACCATG
CAGGAGATCATCAAGCCGACACGGTGAAGCGCATCCAGGGATACGGGCTG
CCATTCCCCAAGGATACGACGCGCAAGGGCCGACCTCTGGTGGCCTTCGA
CTTTCAGTTCCCGAAAAGCTGACCGCCGCCCAGAGGAGGTGCTCAAGGAC
ATGTTAGCAGCTTTCTAAAACATTCGTTTGGGCGCCGCGGGCCCAGTAAT
GGGCCATAATCCTAATTCTAACC

FMO10195.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:55:02
Subject Length Description Subject Range Query Range Score Percent Strand
CG5001-RD 1755 CG5001-RD 339..1388 9..1056 5065 99.1 Plus
CG5001-RA 1833 CG5001-RA 417..1466 9..1056 5065 99.1 Plus
CG5001-RB 1893 CG5001-RB 477..1526 9..1056 5065 99.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:54:59
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 1192253..1192626 461..834 1870 100 Plus
2L 23513712 2L 1191968..1192199 233..464 1160 100 Plus
2L 23513712 2L 1191684..1191910 9..235 1135 100 Plus
2L 23513712 2L 1196213..1196440 831..1056 825 94.8 Plus
3L 28110227 3L 5751369..5751551 233..51 300 77.6 Minus
3L 28110227 3L 5750854..5751021 802..635 195 74.4 Minus
Blast to na_te.dros performed on 2014-11-26 16:55:01 has no hits.

FMO10195.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:12 Download gff for FMO10195.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5001-RA 410..1468 1..1060 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:25 Download gff for FMO10195.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5001-RB 472..1530 1..1060 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:41 Download gff for FMO10195.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5001-RB 472..1530 1..1060 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:41 Download gff for FMO10195.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 1196216..1196440 834..1056 96 == Plus
2L 1192256..1192625 464..833 100 -> Plus
2L 1191970..1192198 235..463 100 -> Plus
2L 1191679..1191909 1..234 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:25 Download gff for FMO10195.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 1196216..1196440 834..1056 96 == Plus
arm_2L 1192256..1192625 464..833 100 -> Plus
arm_2L 1191970..1192198 235..463 100 -> Plus
arm_2L 1191679..1191909 1..234 98 -> Plus