Clone FMO10196 Report

Search the DGRC for FMO10196

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:96
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG10628-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10196.5prime Sequence

1154 bp (1022 high quality bases) assembled on 2010-11-05

> FMO10196.5prime
CAGTCGACATGGTGCAAATCTTTAAATTCCTGTTAAAATCCAGCAAATCT
ACCGGTCGTGCCCACTTCCGGCCCACTTTTCTGGACACACTGCGCCTAGC
GGTTCGTGGAGGACATGGTGGAAATGGACTGCCCAAATACGGAGGAGTTG
GTGGCCAAGGCGGTTGCGTCTACTTGGTGGCAAAGGAAGGACTCACCCTT
CGCAAGGTCGTCCAGGGATTGAAGGATAAGCGAGTGGCAGCATCCAGTGG
CGAGGACAGTAGCAAAGCCAGCATCTTTGGACGCCGTGGAGCTGACCAGA
GGATCGAGGTGCCTGTGGGCGTCCAGGTATATGACGACCAACAAAAACTC
ATCGCCGACCTCGACGAGCACGAGGCGACATGCATTGTGGCGGGCGGAGG
TACTGGCGGATGCACGGCCACAAATTTTCTGGGACGTCCCGGGGAGAATC
GCACTGTAAATCTGGACCTAAAGCTAATAGCAGATGTGGGTCTCGTGGGA
TTCCCCAACGCTGGCAAAAGCACCCTTCTTAAGGCCGTGTCCAATGCCAA
ACCAAAAATTGCAGCTTATCCCTTTACCACCATCCGACCCCAGATTGGAA
CCATCGAGTACAGGGACCTGCGCTCCATCACAGTTGCCGATCTTCCCGGT
CTGATCGAGGGCGCCCACGCGAACTTCGGCATGGGTCACAAGTTCCTGAA
GCACATCGAACGCACCCGCCTGCTGGTCTTCATGGTGGATATATTCGGCT
TCCAGCTGAGTCCCAAACATCCGCATCGCGACTGCTTGGCCAATGTGTAT
GCGCTCAACAAAGAGTTGGAGCTCTACGATCCATCGCTGCTGGAGAAGCT
CAGTGTCCTTGCTGCTGAACAAATGGACAAGGAGGGTGCCCACGAGATCT
TTACCAAAGTTTAGCCGCTCGTCAGCGATTTGGTCAGCGGACTTGAACAG
TGCCCCGAGAACTGCGTCCGAAACAGGTGCTCATTTCGACAGCATTGTTC
CCCATTCGGCATGAACTCGTCGAGATCACGCCAGGGAAATTCCAGCTAAG
GAGGACCTTGGTGGCGCTGGCTGTAAAACAGTTCCTGCGACCAAGGACCA
GGTCCAAGAAAACTTAAAACGCCGCTTTGGGGTGGTGGGGGTCCACAAAA
ATAA

FMO10196.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:55:05
Subject Length Description Subject Range Query Range Score Percent Strand
CG10628-RA 1254 CG10628-RA 43..1178 9..1139 5090 97 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:55:03
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 19757950..19758472 573..51 2615 100 Minus
2L 23513712 2L 19757321..19757891 1139..574 2075 93.7 Minus
2L 23513712 2L 19758532..19758573 50..9 210 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:55:04 has no hits.

FMO10196.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:13 Download gff for FMO10196.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10628-RA 34..1093 1..1057 98 == Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:27 Download gff for FMO10196.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10628-RA 36..1095 1..1057 98 == Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:44 Download gff for FMO10196.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10628-RA 36..1095 1..1057 98 == Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:44 Download gff for FMO10196.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 19758532..19758577 1..50 92   Minus
2L 19757950..19758472 51..573 100 <- Minus
2L 19757404..19757891 574..1057 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:27 Download gff for FMO10196.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 19758532..19758577 1..50 92   Minus
arm_2L 19757950..19758472 51..573 100 <- Minus
arm_2L 19757404..19757891 574..1057 97 <- Minus