Clone FMO10204 Report

Search the DGRC for FMO10204

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:4
Vector:pMK33-CFH-BD
Associated Gene/TranscriptUev1A-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10204.5prime Sequence

335 bp (335 high quality bases) assembled on 2010-11-11

> FMO10204.5prime
CAGTCGACATGACGCTCACCTACTGGATCGGCATGATCATCGGTCCGCCT
AGAACACCATTCGAGAATCGAATGTATTCACTAAAGATCGAGTGCGGCGA
ACGCTATCCGGATGAGCCACCAACGCTCCGGTTTATAACTAACGTAAACA
TTAACTGCATTAATCAGAACAATGGCGTGGTTGATCATAGATCAGTTCAG
ATGTTGGCCAGATGGAGTCGCGAGTACAATATAAAAACGATGCTGCAGGA
AATCCGTAGGATTATGACCATGAAAGAGAACCTGAAGCTGGCACAGCCGC
CAGAAGGTAGCTGTTTTGCAAGCTTTCTAGACCAT

FMO10204.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:02:00
Subject Length Description Subject Range Query Range Score Percent Strand
Uev1A-RC 1189 CG10640-RC 149..461 5..317 1550 99.7 Plus
Uev1A-RB 1609 CG10640-RB 303..615 5..317 1550 99.7 Plus
Uev1A-RA 1196 CG10640-RA 192..504 5..317 1550 99.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:01:58
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 5363878..5364016 317..179 695 100 Minus
3L 28110227 3L 5364082..5364209 181..54 625 99.2 Minus
3L 28110227 3L 5364943..5364991 53..5 245 100 Minus
Blast to na_te.dros performed on 2014-11-26 17:01:59 has no hits.

FMO10204.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:25 Download gff for FMO10204.5prime
Subject Subject Range Query Range Percent Splice Strand
Uev1A-RA 189..504 1..317 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:14:50 Download gff for FMO10204.5prime
Subject Subject Range Query Range Percent Splice Strand
Uev1A-RA 189..504 1..317 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:44 Download gff for FMO10204.5prime
Subject Subject Range Query Range Percent Splice Strand
Uev1A-RA 189..504 1..317 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:44 Download gff for FMO10204.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 5364943..5364994 1..53 96   Minus
3L 5364084..5364209 54..179 99 <- Minus
3L 5363878..5364015 180..317 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:14:50 Download gff for FMO10204.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 5358043..5358094 1..53 96   Minus
arm_3L 5357184..5357309 54..179 99 <- Minus
arm_3L 5356978..5357115 180..317 100 <- Minus