Clone FMO10208 Report

Search the DGRC for FMO10208

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:8
Vector:pMK33-CFH-BD
Associated Gene/TranscriptSam-S-RG
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10208.5prime Sequence

785 bp (216 high quality bases) assembled on 2010-11-11

> FMO10208.5prime
CAGTCGACATGATAAGCGCCGAGTGCCATTCAGAAGAATACACCCCAAAT
GACAAAATGTGCGACCAAATCAGCGACGCTATCTTGGATGCCCATCTGAA
GCAGGATCCAAACGCGAAGGTGGCGTGTGAAACCGTCGCCAAGACGGGCA
TGATTCTGCTGTGCGGCGAGATCACGTCTAAGGCTGTGGTCGACTACCAG
AAGGTTGTTCGCGAGACAGTGCAGCACATTGGTTATGATGACTCCTCCAA
GGGTTTCGATTGGAAGACACTTAACCTGCTTGTAGCCATCGAGCAACAGT
CGCCCAACATTGCCAACGGCGTTCATATCAACCGCGAAGAAGAAGACGTC
GGCGCTGGTGACCAGGGTATCATGTTTGGATATGCCACCGACGAAACCAA
GGAATGTATGCCCCTAACCGTCGTTTTGGCTCACAAACTAAACGAAAAGA
TTGCTGACCCCCCCCGCTCAGATGTGTTCTGGTGGGCTCGCCCCGATTCC
AAAACACAAGTAACCTGCGAGTACCTCTTCAATCAGGGATCAGCAGTTCC
CAAGCGCGCCCACACTATTGTAGTGTCCATGCAGCATTCTGAAAAGATAT
CGTTAGAAACCCTGCCCCCCCCCACTCATTAAAAAAAGTTGTTAAAGTAG
TCATTCCCGCCAAATACATTGATGCCCCCCCCCCCCTCCTTTTATTTATT
ACTTGTGGGCCCCCGGAATCGGTGGACCTCTGGGGTGACGCTGGGCTTAC
ATGTATATAATATTTTTGTAGACCTTATGGAGGCT

FMO10208.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:02:10
Subject Length Description Subject Range Query Range Score Percent Strand
Sam-S-RG 1971 CG2674-RG 158..823 9..676 3005 96.9 Plus
Sam-S-RJ 2309 CG2674-RJ 316..939 51..676 2795 96.6 Plus
Sam-S-RC 2380 CG2674-RC 387..1010 51..676 2795 96.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:02:08
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 112687..112998 363..676 1220 93.3 Plus
2L 23513712 2L 110754..110879 129..254 615 99.2 Plus
2L 23513712 2L 111004..111118 252..366 575 100 Plus
2L 23513712 2L 110405..110483 51..129 395 100 Plus
2L 23513712 2L 109751..109793 9..51 215 100 Plus
Blast to na_te.dros performed on 2014-11-26 17:02:09 has no hits.

FMO10208.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:27 Download gff for FMO10208.5prime
Subject Subject Range Query Range Percent Splice Strand
M(2)21AB-RG 136..888 1..760 93   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:00 Download gff for FMO10208.5prime
Subject Subject Range Query Range Percent Splice Strand
Sam-S-RG 150..902 1..760 93   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:50 Download gff for FMO10208.5prime
Subject Subject Range Query Range Percent Splice Strand
Sam-S-RG 150..902 1..760 93   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:50 Download gff for FMO10208.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 111005..111117 253..365 100 -> Plus
2L 110755..110877 130..252 99 -> Plus
2L 110406..110483 52..129 100 -> Plus
2L 109743..109793 1..51 94 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:00 Download gff for FMO10208.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 111005..111117 253..365 100 -> Plus
arm_2L 110755..110877 130..252 99 -> Plus
arm_2L 110406..110483 52..129 100 -> Plus
arm_2L 109743..109793 1..51 94 -> Plus