Clone FMO10209 Report

Search the DGRC for FMO10209

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:9
Vector:pMK33-CFH-BD
Associated Gene/Transcript
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10209.5prime Sequence

1025 bp (672 high quality bases) assembled on 2010-11-11

> FMO10209.5prime
CAGTCGACATGATGCTAATGCACGAGAAACTCATGGCCGGGCAGTTCTTC
GATCTCAAGACTGATCGCAAGCCCCTGATGCACCACCACCAGTACCAGCA
CCACCAGCAGCAACCACTGCACCACTTGCCGCACAGCCAATTGCCGGTTC
AGGGATCCTTGGGCCTACCCAAAATGGATCTGTACACGGCCTACGCCTAC
CAGCAGCAGTTGCTGGGAGCTGCCCTCAGTCAGCAGCAACAACAGCAACA
GCAGCAGCAGCAACATCAGCAGCTGCAGCAGCAGCATACCTCCTCTGCAG
AGGTCCTGGATCTTTCCCGTCGATGTGACAGCGTAGAGACACCCAGGAAG
ACTCCCTCGCCGTATCAAACAAGCTATAGCTACGGCAGTGGTTCCCCCTC
GGCTTCGCCCACCAGCAATCTTCTGTATGCCGCCCAAATGCAACAGCAGC
AACATCAGCAGCAACAACAGCAACAGCAGCAGCAGCAACAATTAGCCTCC
CTGTATCCCGCTTTTTACTACAGCAACATCAAGCAGGAGCAAGCCACGCC
CACTGCTGCTCCGCCCAAGGTTACACCAACCGCTAACCTTCTGCAAACCT
TTGCTGCCGCCTCTGCTGCGGCCGCCGCTGCTGCTGCCGCTTCTTCGACC
AACTCACCAAGACCCGCCCCCAAACGCCAGCACCATGCAGATAGACGTTC
TGGAGAATCCCCTGTCACCGGCTGTTGAGGTCATCACGCCTATTACTTCC
AGCAGCGGCGAGGCGGGCACCTAATATTCTGTTCTCTTCAAGGCCTTTCC
CCGGGATCCCTTGGTCATAGCTGCCAATTTCGCAGCCACTGATGTCCTTT
TGGACAATCCGCGAGTGGAGCGCTACACGGAATACCCGCCAGTGATTTAC
ATAGATTCTTTTCCCGCAGCTCCAACGGAGGATCGCCGCACCGTAACCCA
CCCCAAAAATGCGAAGGACCACTCAAGAAGTTGATCCGTCACGAAGCAGC
TCCTTCAACCACCAACCAGCCGAAT

FMO10209.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:02:13
Subject Length Description Subject Range Query Range Score Percent Strand
gt-RB 1780 CG7952-RB 116..1111 12..1016 4230 95.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:02:11
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 2427808..2428726 991..63 3745 95.3 Minus
X 23542271 X 2428801..2428852 63..12 260 100 Minus
Blast to na_te.dros performed 2014-11-26 17:02:12
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2347..2387 641..601 115 75.6 Minus
TART-B 10654 TART-B DM14101 10654bp Derived from U14101 (g603662) (Rel. 42, Last updated, Version 1). 156..214 644..588 109 69.5 Minus
TART-B 10654 TART-B DM14101 10654bp Derived from U14101 (g603662) (Rel. 42, Last updated, Version 1). 9186..9244 644..588 109 69.5 Minus

FMO10209.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:27 Download gff for FMO10209.5prime
Subject Subject Range Query Range Percent Splice Strand
gt-RB 101..1107 1..1016 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:01 Download gff for FMO10209.5prime
Subject Subject Range Query Range Percent Splice Strand
gt-RB 105..1111 1..1016 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:52 Download gff for FMO10209.5prime
Subject Subject Range Query Range Percent Splice Strand
gt-RB 105..1111 1..1016 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:52 Download gff for FMO10209.5prime
Subject Subject Range Query Range Percent Splice Strand
X 2428801..2428863 1..63 92   Minus
X 2427775..2428725 64..1025 95 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:01 Download gff for FMO10209.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 2322834..2322896 1..63 92   Minus
arm_X 2321808..2322758 64..1025 95 <- Minus