Clone FMO10211 Report

Search the DGRC for FMO10211

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:11
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG5290-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10211.5prime Sequence

1033 bp (872 high quality bases) assembled on 2010-11-11

> FMO10211.5prime
CAGTCGACATGGTTGCCGATATATTCAGTGAATATTATATATGCAATTTC
AACGATGCGGTGACAGTTGAAGATCTGCCCGCGGATGAGACACTGCGTCA
ATTGTGGACCCGCCAGAAACTGTGGACAATAGATGAACTCCGGGAGATCC
TTCAACGCTGGCAGGAGCATGTCAAGCCAGATCCGAATGATAATCCCACC
TCACAACTCAAGGATTTCCTGCTGCTGATATTCGCTTTTGTTCAAAACAG
TTTTACTGGGCCCTTTGACAAACTCGAAGAGTACCAACAAATCCATAGTG
AACTAGAGCTGGAGAAACTCGACGCACTCGAGAAACTGAAGGCCAGCGGC
GAGGAACTGAATCCAAATGTTATATCTGTAGAACTACTACTGATTGCCAG
GGAAATCCTTGAGGGACTTTTAGAAAACCATCCAGAATCAAAGGTCCTGA
CTTGGTGGCGATTGCGTCTGATCTGCCTGCATCAACATGTGCTGGATGAT
TTGGCGGCCTCCCTGTATGAGCAGTTTAAGTCAGCAGCTGGACATCTTCA
GGCTCATTTCAATCAGTTTGAGAGCAGGGAACTGCAATCCCTGCTACTAC
TGGAGTTGGCCAATGGCTACCTGCAGTTTCATCGCTCTGAAATAGCCTCC
CAAATACTGGATGAACTGTGTAAGTATCTCCAGGTGGAGCTAAAAGTTGA
GGGTTTACTACGAGTACGCACCACATTCCAGCAGAATGCTCTGCCACAAC
TCTGCCTCACAGTCGAGTATCTAATCGAGCAGCAGCCTCTGCCTCCAGCC
GTCCAAACAAATGAGACGACCAAATTGCCAAAACTGCTTCTTCTGGAGGA
TGACACGCGACTGGAGCGGATACGCTTTCAGTTTCTGATTGTTATTCGAA
GTGATGACGCTTCCCAGTGTCTCAAGCTCTGGTGCTGGCCAAAGTAAAGC
AATTGAACGCTCAACGCCTACGATCGCTGCCGATGAACACCTGCAGCGTA
TACACAAATCCCTTACTTTACCAGGAAACGACA

FMO10211.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:01:47
Subject Length Description Subject Range Query Range Score Percent Strand
CG5290-RA 2917 CG5290-RA 255..1277 9..1027 4475 96.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:01:46
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 17911269..17911773 945..442 2070 94.9 Minus
3L 28110227 3L 17911824..17912198 445..71 1845 99.5 Minus
3L 28110227 3L 17912248..17912311 72..9 320 100 Minus
Blast to na_te.dros performed on 2014-11-26 17:01:46 has no hits.

FMO10211.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:22 Download gff for FMO10211.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5290-RA 247..1272 9..1032 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:14:39 Download gff for FMO10211.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5290-RA 255..1280 9..1032 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:37 Download gff for FMO10211.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5290-RA 255..1280 9..1032 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:37 Download gff for FMO10211.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 17912248..17912311 9..72 100   Minus
3L 17911826..17912196 73..443 99 <- Minus
3L 17911269..17911771 444..945 95 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:14:39 Download gff for FMO10211.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 17905348..17905411 9..72 100   Minus
arm_3L 17904926..17905296 73..443 99 <- Minus
arm_3L 17904369..17904871 444..945 95 <- Minus