Clone FMO10213 Report

Search the DGRC for FMO10213

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:13
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG5196-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10213.5prime Sequence

1057 bp (906 high quality bases) assembled on 2010-11-11

> FMO10213.5prime
CAGTCGACATGAGTCCTGAAATATCCGGCTTCCGGCGGTTCCTGCATTGG
GGCCCCATTACCGCCCTTAGCATCATCAAGTGCATAACGCTGACAACGCT
CTATATGAACTCGATGTGGTGGCCGCCAAATAAATCATTCGCCGGATTCG
CCCACCAGGCCCTCTTCCTGCTCCTTTCCACGCTGGCCACATTCAATTAC
GTCATGGCCACTTTGACTGGTCCCGGACTGATGCCAAAACAGTGGCATCC
CAAGGATCCCAAGGACGCCCAGTTCCTGCAGTACTGCAAAAAGTGCGAGG
GCTACAAGGCACCACGCTCCCATCATTGTCGCAAGTGTGATCGCTGCGTC
AAGAAGATGGACCATCACTGCCCATGGATCAATCACTGCGTTGGCTGGGC
CAACCACGCGTACTTCACATACTTCCTGCTCTTCTCCATCCTGGGCAGCC
TGCAGGGCACCGTGGTGCTATGCTGCTCCTTCTGGCGGGGAATCTACCGC
TACTACTATCTCACCCACGGATTGGCGCACTTGGCTAGCGTGCAGTTCAC
TCTGCTCAGCATCATCATGTGCATTCTGGGCATGGGCCTGGCCATCGGTG
TCGTCATTGGCCTGAGCATGCTGCTGTTCACTCAGCTGAAGACGATTGTA
AACAACCAGACGGGCATAGAGATCTGGATAGTGGACAACGCCATTTACCG
CCGATATAGGAATGCCGACTGCGACGACGAGTTCCTATATCTCTATGATT
TGGGCTGGCGGGCAAATTTGCGACTGGTATTCAATGACGAGTGCCCCCAA
GCGAGGCGATGGCATCGAGTGGCCAGTGGTGGAGGGTTGTGATCAGTATA
CATTGACGCGCGAGCAACTGGCGCAGATGAGGAGAACGAGCTCGAACCCG
CACCTTCAAATGCACCCACGTCTAGTGACTGGTCCGTTGGCTGCCGATCT
TTTCGCAGGTTGGCGTGTTGTGTGGCCGCTCCCTGCTCCGATGAGCAGCA
TCAGCTGCGACCCACGAACATGATCAACGTCACTCGCCACGCAACAACTG
GCTGATC

FMO10213.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:02:18
Subject Length Description Subject Range Query Range Score Percent Strand
CG5196-RA 1679 CG5196-RA 97..1146 9..1054 4695 97.2 Plus
CG5196-RB 2023 CG5196-RB 502..1490 70..1054 4390 97 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:02:17
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 12410460..12410980 337..858 2455 98.5 Plus
3R 32079331 3R 12409255..12409440 70..255 930 100 Plus
3R 32079331 3R 12410273..12410358 253..338 430 100 Plus
3R 32079331 3R 12411034..12411217 858..1037 355 89.3 Plus
3R 32079331 3R 12408412..12408473 9..70 310 100 Plus
Blast to na_te.dros performed on 2014-11-26 17:02:17 has no hits.

FMO10213.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:28 Download gff for FMO10213.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5196-RA 91..1122 9..1037 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:05 Download gff for FMO10213.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5196-RA 97..1128 9..1037 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:55 Download gff for FMO10213.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5196-RA 97..1128 9..1037 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:55 Download gff for FMO10213.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 12410460..12410980 337..858 98 -> Plus
3R 12410275..12410356 255..336 100 -> Plus
3R 12409255..12409439 70..254 100 -> Plus
3R 12408412..12408472 9..69 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:05 Download gff for FMO10213.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 8236182..8236702 337..858 98 -> Plus
arm_3R 8235997..8236078 255..336 100 -> Plus
arm_3R 8234977..8235161 70..254 100 -> Plus
arm_3R 8234134..8234194 9..69 100 -> Plus