Clone FMO10214 Report

Search the DGRC for FMO10214

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:14
Vector:pMK33-CFH-BD
Associated Gene/TranscriptLpR1-RD
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10214.5prime Sequence

880 bp (694 high quality bases) assembled on 2010-11-11

> FMO10214.5prime
CAGTCGACATGGGGCGCATTTGGTGTTTACTCTTCGTTAGCAGTTTGCTG
CACACTCAGAGCCAAAGTTTTCGCGTTCTGGCTATAAATGAGGCCACTTG
CTCGTCGGACCAATTCCGTTGCGGGAATGGCAACTGCATACCGAACAAAT
GGCGCTGCGATCAGGAGAGCGATTGTGCCGATGGCTCCGATGAAGCCAAC
GAATTGTGCAGAGCTCGAACCTGTTCACCGGATGAATATGCCTGCAAGAG
TGGCGAGGGGCAATGTGTTCCTTTGGCCTGGATGTGCGACCAGAGCAAGG
ACTGCAGCGATGGCTCCGACGAGCACAACTGCAACCAGACCTGTCGTGCC
GACGAGTTCACCTGTTGCAATGGACGGTGCATCCAGAAGCGATGGAAGTG
CGACCACGACGACGACTGCGGCGATGGATCCGACGAGAAGGAGTGCCCAG
TGGTGCCCTGCGACTCCGTGGCGGAGCACACCTGCACGAATGGAGCCTGC
ATCGCCAAGCGGTGGGTCTGCGACGGTGATCCGGACTGCTCCGATGGCTC
CGATGAGCGGTCCTGTGCGAATGTGACCAAGACGACCACGCCCTGCACCA
CAGCACGAATACCAGTGCAAGGATCGCATCACCTGCCTGCATCACAGCTC
GCCTCTGCCATGGTGACCGCGACTGTCCCGATGGCGACGATGAGCACCCA
GCCAACTGCTACCACCGTCACCTGTCGGGCGGACCAGTTCCAGTGCGGCG
ACTCCTAGCTGCATTCCAGGACATCTCACCTGCAACGGCGACAGACTGCG
CCGATGGCAGCGACGACGGATGCGATGAGTCTGAGTCTGGGGATCCACCC
ACGCTGATGCTCGCATCCAGCGATCGACTG

FMO10214.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:02:21
Subject Length Description Subject Range Query Range Score Percent Strand
LpR1-RG 3546 CG31094-RG 245..1122 9..880 3750 95.9 Plus
LpR1-RD 3369 CG31094-RD 245..1122 9..880 3750 95.9 Plus
LpR1-RL 3798 CG31094-RL 755..1551 90..880 3345 95.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:02:19
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 25747007..25747233 560..334 1105 99.1 Minus
3R 32079331 3R 25746139..25746393 816..560 835 92.7 Minus
3R 32079331 3R 25748103..25748225 333..211 615 100 Minus
3R 32079331 3R 25749269..25749390 211..90 610 100 Minus
3R 32079331 3R 25752061..25752142 90..9 410 100 Minus
3R 32079331 3R 25709411..25709513 440..338 230 81.6 Minus
Blast to na_te.dros performed on 2014-11-26 17:02:20 has no hits.

FMO10214.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:29 Download gff for FMO10214.5prime
Subject Subject Range Query Range Percent Splice Strand
LpR1-RD 245..1099 9..860 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:06 Download gff for FMO10214.5prime
Subject Subject Range Query Range Percent Splice Strand
LpR1-RD 245..1099 9..860 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:57 Download gff for FMO10214.5prime
Subject Subject Range Query Range Percent Splice Strand
LpR1-RD 245..1099 9..860 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:57 Download gff for FMO10214.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 25752061..25752142 9..90 100   Minus
3R 25749270..25749389 91..210 100 <- Minus
3R 25748103..25748225 211..333 100 <- Minus
3R 25747007..25747233 334..560 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:06 Download gff for FMO10214.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 21577783..21577864 9..90 100   Minus
arm_3R 21574992..21575111 91..210 100 <- Minus
arm_3R 21573825..21573947 211..333 100 <- Minus
arm_3R 21572729..21572955 334..560 99 <- Minus