Clone FMO10216 Report

Search the DGRC for FMO10216

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:16
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG4877-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10216.5prime Sequence

961 bp (720 high quality bases) assembled on 2010-11-11

> FMO10216.5prime
CAGTCGACATGTCCAACGAGATCTACGACTCCTCCAATTCGCAGCTAAGT
AGCGACGAGTATAGCCACGAGGAGGAGGAATACGACGCTCTAATGGACGC
GGCGGTGAGCAAGCAACGACCCCAAAAGACAAAATCCAAGGGATCCGAGT
CCGAGAAACCCGGAAATGGAGCTCCAGAATCGGCGGCTGCCACTGAGAAA
AATGAAAAGCCAGATGACGATGCGGTGCCACCTTCCACGCGCTCAGAAAC
AATTCGGCGGATCCGGCAATTGCAGTTACAGCGTGGCAGGCTGCCCAATC
TTTACTTCAAGCGTCGCAGTATTCGTTGGCTGCGACCCAATAAAATGGAC
TACAACAGCTATTTTGACGGCCTGAAGGACTTGCTGCCCAAGCGTAAATT
GAAGCACCTGGTTCGCTTCCATGACAGGCAGCGCAGAACCTACGACAGCA
GGAGCATCAGTCGTAGTCGCAGCCACAGCCGCAGTCTTAGCCGAAGTTGC
AGTCGCAGTCGTAGTCGTAGCTATTCTCGCAGCCGCAGCGGCAGTGGTTC
GCCGGAACTCATTTGCCTTGACGACACGGACAACGAGGATTCGCCTGAGA
AACCAGAGCAAGAGCCGGCAAGGGTTACGCCCATCAAGGAAAATAACCCC
CACCCTTTTTGGCTCCACCCCAACTAAACTACGAGCTGCCAGAAAGGAAG
AAAGCCCCCCCCCCCCCGCCCAACAACGAAAACTGTGCCTCTATCCTCGA
CGAGTTCCTGGTAAGAAGGATCACAGGAACCGGTCTTCGACTACGGTATA
CTCTCTCGTGTCGGGAATTGGCACCGCCTTTTAATATGTATCTGGTCGCG
ACATGCGCCAATGAGGCAGAGTCGCTTGTGGTTGATGCCACTCTTAAAAG
ACGCCGTTCGGTAACACCGCCCGCTAGCGAGAGAAGCGCAACCATGACGT
CGACGCATCAT

FMO10216.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:02:26
Subject Length Description Subject Range Query Range Score Percent Strand
RAF2-RC 4076 CG4877-RC 250..1190 9..953 4010 95.6 Plus
RAF2-RA 4082 CG4877-RA 256..1196 9..953 4010 95.6 Plus
RAF2-RB 4006 CG4877-RB 180..1120 9..953 4010 95.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:02:25
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 16387020..16387641 328..953 2170 92.6 Plus
3L 28110227 3L 16386637..16386957 9..329 1605 100 Plus
Blast to na_te.dros performed on 2014-11-26 17:02:26 has no hits.

FMO10216.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:30 Download gff for FMO10216.5prime
Subject Subject Range Query Range Percent Splice Strand
CG4877-RA 230..1185 1..961 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:11 Download gff for FMO10216.5prime
Subject Subject Range Query Range Percent Splice Strand
RAF2-RB 172..1127 1..961 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:45:01 Download gff for FMO10216.5prime
Subject Subject Range Query Range Percent Splice Strand
RAF2-RB 172..1127 1..961 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:45:01 Download gff for FMO10216.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 16387021..16387648 329..961 93   Plus
3L 16386629..16386956 1..328 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:11 Download gff for FMO10216.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 16380121..16380748 329..961 93   Plus
arm_3L 16379729..16380056 1..328 98 -> Plus