Clone FMO10217 Report

Search the DGRC for FMO10217

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:17
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG15609-RG
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10217.5prime Sequence

648 bp (648 high quality bases) assembled on 2010-11-11

> FMO10217.5prime
CAGTCGACATGGCCAGCGTATGGAAGCGATTGCAGCGCAATTTCAAGCGA
GCCGCCAAATTCCAGTTCACCGCATCGTACCACGATCTGCATCTGGAAAC
CACCGCCAAGTGGCGGCCGTCGAACCTCTCTATCGTTTGGACCAGAAGAT
CTAGACGAGTGGCCAGTGCTCCTTTGCCATGGGAGCCGGACATGATGAAC
CCCTTGGTGGGCAATATATCCTGGCCAGTGCCCGACAATCACACCATATC
CGTCACCCTGTTTAAGGATCCTCGGACACACGAGCTGGAGGACAAGGACT
GGACGTTTGTCATCGAAGATGTCACTCCAATGGGCAAGAAACGTGTGCTG
GCCAATGCCAGCATTAATATGAGGAAGTATGCCAGCATAGAATCCACTCA
GCAGAGCTTTACCTTGAGCCTAAAGCCAGTCTCGAAGAAGATTACTGCAG
CCAGTTTGGAGCTCACGATTAGCTGTGTATTTTTGCGAGAAGGAAACGCT
ACAGACGAGGACATGCAGAGCGTTGTCTCCATGATGTCCGTGAACAACAA
TGATGTGGCGCCTTTGGATGACTTGGAGGATATTCCAGATCTTGATGGCT
TTAGTGAAATTACGGACCCCCCCCCCTGACTTTACACAGCAACTGGAG

FMO10217.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:02:29
Subject Length Description Subject Range Query Range Score Percent Strand
Ehbp1-RG 3829 CG15609-RG 383..1021 9..648 3040 98.4 Plus
Ehbp1-RF 4361 CG15609-RF 387..1025 9..648 3040 98.4 Plus
Ehbp1-RI 4152 CG15609-RI 387..1025 9..648 3040 98.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:02:28
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 17013787..17013997 322..112 1055 100 Minus
2R 25286936 2R 17013546..17013727 502..321 895 99.5 Minus
2R 25286936 2R 17013367..17013481 617..503 575 100 Minus
2R 25286936 2R 17014948..17015052 113..9 525 100 Minus
Blast to na_te.dros performed on 2014-11-26 17:02:28 has no hits.

FMO10217.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:31 Download gff for FMO10217.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15609-RG 375..1013 9..648 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:12 Download gff for FMO10217.5prime
Subject Subject Range Query Range Percent Splice Strand
Ehbp1-RI 387..1025 9..648 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:45:03 Download gff for FMO10217.5prime
Subject Subject Range Query Range Percent Splice Strand
Ehbp1-RI 387..1025 9..648 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:45:03 Download gff for FMO10217.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 17014949..17015052 9..112 100   Minus
2R 17013789..17013996 113..320 100 <- Minus
2R 17013546..17013727 321..502 99 <- Minus
2R 17013337..17013481 503..648 93 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:12 Download gff for FMO10217.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 12902454..12902557 9..112 100   Minus
arm_2R 12901294..12901501 113..320 100 <- Minus
arm_2R 12901051..12901232 321..502 99 <- Minus
arm_2R 12900842..12900986 503..648 93 <- Minus