Clone FMO10219 Report

Search the DGRC for FMO10219

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:19
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG32549-RE
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10219.5prime Sequence

926 bp (511 high quality bases) assembled on 2010-11-11

> FMO10219.5prime
CAGTCGACATGCCACAGCCAAAGCAAAACCAGCAGAAACAGCCACAGCCA
CAACAGCAAAAGCCGCTGCAGAAACATTCCAGCACCAGCTCCACGATCAT
CGCCAAGCCGGAAAAGGAACGGGAACGCACGCAGACGATCGGCGAAACCG
ACATGGATCAGTCGGTGCTCAATGGACTGGCAGTGGGCGCAGATGGAACC
GCCGGCTACCATGGTCACCAGCGAGAACTTGGTCACAGAGTGTTTGTGAA
CAGATCGCTGCATTTGGAGAATATCAAGTACTATGGCTTCGATATGGACT
ACACCTTGGCAGAGTACAAGTCACCGCAGTATGAGCAGCTGGGCTTCAAC
CTGGTCAAGGAGCGCCTGGTCTTCATGGGCTACCCCAAAGTTTACCTGCA
CTTCGAGTACGATCCCACCTTCCCAGTACGCGGCCTGTGGTTCGACACTC
TCTACGGGAATCTGCTGAAAGTGGCACCCCACGGCAACATCCTGGTCTGC
GTTCATGGCTTCCAGCTCATCACACATCACCAGGTGTACGAGTTGTATCC
CAACAAGTTCTTGAAACTGGACCACCCCCGTGTCTATGTCCTGAATACTC
TCTTCAATCTTCCTGAAACCTATCTCCTTGCCTGTCTCCCCCCACACCTC
TTACCAACACCACCGACTTTGTGCGCGTTGAGCGCGGCATCAAAGCTGGC
CCCCCCCCCCCCTACCTACAAGTCTATTTTCCACCCCGTGCGACGTGCCG
TCGACTGGGTGCACTCGATGGCGATCTGAATTTTTTTTATTATTCAGATA
GGCTCACTATGCGCACCCAAGATGAGAGTATGCCCACCGTCCCTTCCCGA
ATCCGGGAGTCGGGCGCCAAACTCTTTATGCTGACCAACAGCGACTATAC
GTACACAACGAGATCATGACCTACCT

FMO10219.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:02:36
Subject Length Description Subject Range Query Range Score Percent Strand
CG32549-RE 2509 CG32549-RE 372..1288 9..926 3455 92.3 Plus
CG32549-RH 2677 CG32549-RH 771..1462 234..926 2345 90 Plus
CG32549-RG 2806 CG32549-RG 900..1591 234..926 2345 90 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:02:34
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 18403985..18404214 238..9 1135 99.6 Minus
X 23542271 X 18392549..18392765 526..310 890 94 Minus
X 23542271 X 18392370..18392481 638..527 500 96.4 Minus
X 23542271 X 18391836..18391939 926..824 395 94.2 Minus
X 23542271 X 18392837..18392914 312..235 390 100 Minus
X 23542271 X 18392056..18392124 780..713 205 89.9 Minus
Blast to na_te.dros performed 2014-11-26 17:02:35
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6853..6947 11..106 180 68 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2595..2678 27..108 163 70.9 Plus

FMO10219.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:32 Download gff for FMO10219.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32549-RE 1186..1265 848..926 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:16 Download gff for FMO10219.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32549-RE 1209..1288 848..926 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:45:05 Download gff for FMO10219.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32549-RE 1209..1288 848..926 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:45:05 Download gff for FMO10219.5prime
Subject Subject Range Query Range Percent Splice Strand
X 18403985..18404224 1..238 97   Minus
X 18392837..18392910 239..312 100 <- Minus
X 18392549..18392762 313..526 93 <- Minus
X 18392335..18392481 527..675 90 <- Minus
X 18392056..18392160 676..780 83 <- Minus
X 18391836..18391915 848..926 98 == Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:16 Download gff for FMO10219.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 18298018..18298257 1..238 97   Minus
arm_X 18286870..18286943 239..312 100 <- Minus
arm_X 18286582..18286795 313..526 93 <- Minus
arm_X 18286368..18286514 527..675 90 <- Minus
arm_X 18286089..18286193 676..780 83 <- Minus
arm_X 18285869..18285948 848..926 98 == Minus