Clone FMO10220 Report

Search the DGRC for FMO10220

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:20
Vector:pMK33-CFH-BD
Associated Gene/TranscriptPole2-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10220.5prime Sequence

992 bp (726 high quality bases) assembled on 2010-11-11

> FMO10220.5prime
CAGTCGACATGGATGTGGATTTACTGCCGCTGAGAAAGCGAATAACGAAC
ACTTTCAAGTTATGTGGATTCCTGATCCGCTCGGAGAACAGTTCCTACCT
GGCGGAGCAGCTGCTGCCCTTCGACGCAGCGGAACGGGACAAATGGCTGA
CGGTGATCACCGAGAATCTCCAAAGCCAAAAGCTTTTGACGCCTCATGTG
GAGCGAGCCGCCCTGGAGAAGGCTATCAATGAACTTAACCGGGTGGGATT
GGATGAAGGGGAGACGGTCTTTGCCCTGATCGATGCCTTTACGGTGCCCC
GTTTTCGGTACAACCAGCGGATAAAGAAATTCGAACTGGACACACAGCCG
CGCCAGTTGCTGACCGCTCCGCGCATGAAATCGGACTACATGCAGCAACG
ATATGCCATGTTACTACAGAAAACTCTGCGACACGACCTCTTTGCCCCAG
CCGTCATCCACGATGGCGTTGGAGCCGAGGCCCAGGCCAAGAAATTTAAG
CTCCAGTTCGCTGAGAACCTGCTGGCCACGTCGGCGATGAAGGAGGCAGT
TGTTTTGCGACTACTTACCCAGCTTAAGGAGGGCAAGTTCTATGTCGAGG
ATCCCACGGGTTGCGTCCACCTACATCTCACTGGAGCCCGTTTCCATGCC
GGCTTCTTCTGCGAGGGCTGCTTTGCCCCCCCCCCATGTTTATTATTACA
ACGGTGTGCTCAAGGTTGATGGCCTGCGCTTTCCACCCGCGGAATTTGCT
AACAGCTTTCGAGCATTTTTCGGCACCGCCCACACCTCGGGGCGGTGAAT
CTGCTAAGCTGCTGAAGTACTCAGCCGGACTACAGGAACTGGAGCGTACC
ACACGGAAACAACCATTGTTTTCCTTTCCGACGTACGGTTGGATCTGCCC
GCTCTCTCCACGAAGAAGCTGTAACAAGTCGCTCCGTGGGCTATGATTTC
CTGCCCGCCCCCAAGCTATAGTGCTCATGGGGCCCCTTTCAC

FMO10220.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:02:39
Subject Length Description Subject Range Query Range Score Percent Strand
DNApol-epsilon58-RA 1688 CG10489-RA 57..1025 9..985 3805 93.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:02:38
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 5896713..5897379 675..9 3050 97.2 Minus
3L 28110227 3L 5896433..5896617 899..715 665 93 Minus
Blast to na_te.dros performed on 2014-11-26 17:02:38 has no hits.

FMO10220.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:33 Download gff for FMO10220.5prime
Subject Subject Range Query Range Percent Splice Strand
Pole2-RA 1..974 9..992 93   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:18 Download gff for FMO10220.5prime
Subject Subject Range Query Range Percent Splice Strand
Pole2-RA 57..1030 9..992 93   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:45:07 Download gff for FMO10220.5prime
Subject Subject Range Query Range Percent Splice Strand
DNApol-epsilon58-RA 57..1030 9..992 93   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:45:07 Download gff for FMO10220.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 5896674..5897379 9..715 95   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:18 Download gff for FMO10220.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 5889774..5890479 9..715 95   Minus