Clone FMO10223 Report

Search the DGRC for FMO10223

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:23
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG8910-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10223.5prime Sequence

1074 bp (736 high quality bases) assembled on 2010-11-11

> FMO10223.5prime
CAGTCGACATGCCCTTCGGCCGCAAGTCCCCGCTGGAGGCACTGGCCCTT
CCCGGCGTCATGCTCGCCTACAAGTACAGCCAGTTCCGCCAGCGCCGCCG
GGAGGCCGCCAGCCGACGGGTCACCGAGCGCGAACTCTCGGCGCTGCACC
ATAAAATCGACAAACTACTGAGTAAACTGGAGGAGGAAAGCGAGCCGGAT
CCTCCAACCTCCCAGGAGGACGAATGTGTGATCTGCATCAATGCCCGGGC
CACCATGCAGACATCGCCATGTGGCCACCGCGTCGTCTGCCGCCGCTGCT
TTGTGAAGACCATTCAGAGTGCGGTGGCCCAACGACTGTTGCCCCTTCGC
TGCGTCATTTGTCGAGCGCGGGTCAATCGTCTGTCCTCGTCCTCGGGCAC
TTGGCGAATCCAGGAGTCGGCCAGCAGCTACTCAATGGGCGCCAAGAGTT
GGGCCTCCGCCGGAGCACGCCGCCGGCGGTGTGGTACCCTCGGCGAGCTC
CTACTCGATGAACGATGCGCACAGCGGCCACCATTCGTTCCACCAGCCCA
CGCTGCACAAGTCGGCGGTGGGACGGCATCACCCGCATCATTACGCCGCC
CGAGGATCAGCCCATGCTCGAGTCTCCCACTCGGATAGCTTGTACTCGAT
GAGCTCGACGGGATCGGCGGCTTCATCGGCCTCCGGTTATTCACTTTTAT
TTAATATTTCTTCCATATCGAGCAACGGTCCCTGCTCACCGGCCTCGCCG
GCGTGGCTTCCTTCTTCTATCATCTGGCACCGCCATCTCCCACCACCCCA
CTATTTTATTCATATTCTGGCCTCACCCCACTCCCATCGGGATCATCGGG
CAGTTCTCTTTCACCGCGGGAAAATGGAACTTCACATTCCGCATCATGGT
GGGTGTCCCATTGGTTTGCTCCCGCTGCCTGTGCCTAGATAATTGTCTCA
CACGCTCACCAATAGCCCATCCACGCCCCATTTCCCGTTCATCGTCGAGC
GGAAGTGGGGGAGGAGGAGTGGGCCAACGGCCACCGGTCAGCGTTACCAG
GTGCAACTGATGACGCCCTTACGT

FMO10223.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:02:15
Subject Length Description Subject Range Query Range Score Percent Strand
CG8910-RA 3406 CG8910-RA 448..1493 9..1067 4310 94.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:02:14
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 16877180..16878037 1024..159 3280 94.6 Minus
2R 25286936 2R 16894119..16894269 159..9 755 100 Minus
Blast to na_te.dros performed on 2014-11-26 17:02:15 has no hits.

FMO10223.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:28 Download gff for FMO10223.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8910-RA 440..1471 1..1044 94   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:03 Download gff for FMO10223.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8910-RA 441..1472 1..1044 94   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:53 Download gff for FMO10223.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8910-RA 441..1472 1..1044 94   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:53 Download gff for FMO10223.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 16894120..16894276 1..158 97   Minus
2R 16877163..16878037 159..1044 94 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:03 Download gff for FMO10223.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 12781625..12781781 1..158 97   Minus
arm_2R 12764668..12765542 159..1044 94 <- Minus