Clone FMO10224 Report

Search the DGRC for FMO10224

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:24
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG9657-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10224.5prime Sequence

1085 bp (876 high quality bases) assembled on 2010-11-11

> FMO10224.5prime
CAGTCGACATGCACGTGGAGGAGCTGAGAGCCAGCCTGCAGAGCTTTGGA
TGGCCGGATTATTTGGTCTTTTGCCTGATGTTGGCCATTTGCGCCGTTAT
CGGTATATATTTTTGCCTGCAACTGCGCTTAGAGTCCAGGAAACAAAAGG
CCAATGGCTCAGAGGAGGCGGCGAGTAGTGCTGCCTCGTATTTGGTTGGT
GGCAGGCAGATGAAGATCTTTCCCATAACCATGTCACTGATATCCAGCTT
TATATCTGGAATTACACTTTTGGGTACTCCCACAGAGGTTTATCTTTATG
GTGCTCAGTACATGTACATTATGGGATCGCTGGTTTTAATGGGCTTCTGC
ATGTACTACTTCTTCTTGCTGGTCTTTCACGAACTCAATTTGATATCCAC
TTATAAGTATTTGGAACAGCGATATAACCGAAGTTTAAGGCTTTTCGGAT
CTGTCATGTTTATTGTGGCTTCGCTACTTTGGCTTCCAATTGTGATTTAT
GTACCGGCTATAGCATTCAATCAGGCCACTGGAGTGAACATCCATATAGT
GACGCCCATTGTGTGTGTGGTTTGCATTTTCTATACTTGCATTGGAGGTT
TGAAGGCGGTGGTTTGGACGGATGTCATCCAAACGTTGATCATGTTCGGT
GCGATGGCTTTGGTTTTGATTAATTGAACCTTGTATATCGGCGGACCTGG
AGTTGTGTGGCACAACGCCCAAGACACAGCTCGATTGTAAGTACCCAATT
TTAGTGCGGATCTAAGCGAGCAGTTATATCCTTTTATTCCCTGGTTTTGG
GCGGTGTAGCTCATTGGCTCAAGTCAAATGCAATTAGTCAGATATGATCC
AGAGATATTTATCGCTACCCACGCTTCGTGCTGCTATAGTATTGCTATAT
GTACATTTATCGCTGGTGTTTTGGCCTTTTTGATGATCTGCGGATATACG
GTCTTTTGATCTATGCCACCTATCTCATGTGATCCTTTGGCAAACGAGTT
GACCCAAAGAATCGATCAACTTTGCCACTTTGGTATGACCTTTGGCTCAT
ATCCGGGTTACCAGGAGTATTTGTAGCGGGGTTCT

FMO10224.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:03:27
Subject Length Description Subject Range Query Range Score Percent Strand
CG9657-RB 2557 CG9657-RB 132..1207 9..1077 4695 96.7 Plus
CG9657-RA 2054 CG9657-RA 132..1207 9..1077 4695 96.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:03:25
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 7420119..7420669 473..1023 2065 94.4 Plus
X 23542271 X 7418725..7418963 9..247 1195 100 Plus
X 23542271 X 7419771..7419933 245..407 800 99.4 Plus
X 23542271 X 7419990..7420057 406..473 340 100 Plus
Blast to na_te.dros performed on 2014-11-26 17:03:26 has no hits.

FMO10224.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:43 Download gff for FMO10224.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9657-RA 132..1215 9..1085 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:58 Download gff for FMO10224.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9657-RA 132..1215 9..1085 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:45:34 Download gff for FMO10224.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9657-RA 132..1215 9..1085 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:45:34 Download gff for FMO10224.5prime
Subject Subject Range Query Range Percent Splice Strand
X 7420120..7420738 474..1085 93   Plus
X 7419992..7420057 408..473 100 -> Plus
X 7419774..7419933 248..407 99 -> Plus
X 7418725..7418963 9..247 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:58 Download gff for FMO10224.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 7314153..7314771 474..1085 93   Plus
arm_X 7314025..7314090 408..473 100 -> Plus
arm_X 7313807..7313966 248..407 99 -> Plus
arm_X 7312758..7312996 9..247 100 -> Plus