Clone FMO10226 Report

Search the DGRC for FMO10226

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:26
Vector:pMK33-CFH-BD
Associated Gene/TranscriptPfk-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10226.5prime Sequence

1074 bp (942 high quality bases) assembled on 2010-11-11

> FMO10226.5prime
CAGTCGACATGAATTCCGAGATTAATCAACGATTCCTGGCCCGCGGCTCG
CAGAAGGACAAAGGACTGGCGGTCTTCACCAGCGGCGGGGATTCCCAGGG
CATGAATGCCGCCGTGCGAGCCTGTGTCCGTATGGCCATCTATTTGGGCT
GCAAGGTCTACTTCATTCGTGAAGGCTACCAGGGCATGGTGGATGGTGGC
GACTGCATCCAGGAAGCCAACTGGGCCTCAGTCTCATCCATTATCCATCG
TGGTGGCACCATCATTGGCTCCGCCCGTTGCCAGGACTTCCGTGAGCGTC
AGGGTCGCTTGAAAGCCGCTAACAACCTGATTCAGCGAGGAATCACCAAT
CTGGTGGTCATTGGAGGCGATGGCTCCCTCACGGGCGCCAATCTGTTCCG
TCAGGAGTGGTCCAGCCTGTTGGACGAGCTGGTCAAGAACAAGACCATTA
CCACCGAGCAGCAGGAGAAGTTCAATGTCCTGCACATCGTTGGATTGGTT
GGCTCCATCGACAACGATTTCTGTGGCACTGACATGACCATCGGCACGGA
CACGGCACTACATCGCATCATCGAGGCAATCGATGCCATCTCCAGTACAG
CCTACTCCCATCAGCGCACCTTCATCATGGAGGTCATGGGTCGTCACTGC
GGTTACTTAGCCATATCGGCAGCCATAGCCACAGAGGCTGATTTTATGTT
CATACCCGCCCCCGCCGGTGTCAGTCAATTGGAAGGACGAGATCTGTGTC
AAGCTCCACCACGAGCGATCTGCTGGCCAGCGTCTGAACATCGTGATTGT
GGCCGAGGGAGCCATGGATCGCCGAGGGTCATCCCATCACAGCCGAGGAT
GTAAAGAAGTGATCGACGAGCGTCTGAGCACGATGCCCGCATCACTGTCT
TGGGTCACGTGCAGCGCGGTGGCAATCCCAGTGCCTTCGATCGTATCTTC
GCCCTGCCGCATGGGGAGCTGAGACACTTGGGCCCTGATGGAGCCACCAA
GACTCGGTGCCAGTGGTCATCTCTCTGACGCACAGCGGTCGCGTGCGCTG
ATGGATGGCGTACAAGCGCACCTA

FMO10226.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:03:32
Subject Length Description Subject Range Query Range Score Percent Strand
Pfk-RC 3188 CG4001-RC 560..1630 9..1072 4755 97.1 Plus
Pfk-RB 3508 CG4001-RB 560..1630 9..1072 4155 93.6 Plus
Pfk-RA 3217 CG4001-RA 634..1659 54..1072 3930 93.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:03:30
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 10112612..10112960 151..499 1745 100 Plus
2R 25286936 2R 10114910..10115101 756..946 785 97.4 Plus
2R 25286936 2R 10113015..10113170 497..652 765 99.4 Plus
2R 25286936 2R 10111429..10111577 9..157 745 100 Plus
2R 25286936 2R 10114125..10114233 652..761 440 95.5 Plus
Blast to na_te.dros performed on 2014-11-26 17:03:31 has no hits.

FMO10226.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:44 Download gff for FMO10226.5prime
Subject Subject Range Query Range Percent Splice Strand
Pfk-RC 533..1569 9..1039 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:16:02 Download gff for FMO10226.5prime
Subject Subject Range Query Range Percent Splice Strand
Pfk-RC 560..1596 9..1039 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:45:38 Download gff for FMO10226.5prime
Subject Subject Range Query Range Percent Splice Strand
Pfk-RC 560..1596 9..1039 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:45:38 Download gff for FMO10226.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 10114917..10115105 763..951 97 -> Plus
2R 10114126..10114234 653..762 94 -> Plus
2R 10113016..10113170 498..652 99 -> Plus
2R 10112617..10112958 156..497 100 -> Plus
2R 10111429..10111575 9..155 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:16:02 Download gff for FMO10226.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 6002422..6002610 763..951 97 -> Plus
arm_2R 6001631..6001739 653..762 94 -> Plus
arm_2R 6000521..6000675 498..652 99 -> Plus
arm_2R 6000122..6000463 156..497 100 -> Plus
arm_2R 5998934..5999080 9..155 100 -> Plus