Clone FMO10230 Report

Search the DGRC for FMO10230

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:30
Vector:pMK33-CFH-BD
Associated Gene/Transcript
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10230.5prime Sequence

931 bp (690 high quality bases) assembled on 2010-11-11

> FMO10230.5prime
CAGTCGACATGTTGCAATCAACGGTTCCGTCATACCACCATCCCCATCCG
CATCACGGCCACCCTCATGCTCATCCCCATAGCCACCACCATGCGTCGAT
GCACCATGCCCATGCCCACCATGCTGCCGCTGCAGCTGCCGCCCACCAGC
GTGCGGTGCAGCAGGCCAACTATGGTGGTGGAGTCGGCGTGGGCGTTGGC
GTCGGTGTGGGCGTGGGCAGTGGCACGGGCAGCGCCTTCCAAAGGCAGCC
AGCTGCCGGCGGATTCCATCATGGCCATCATCAGGGCCGCATGCCGCGTC
TGAATCGCAGCGTTTCGATGGAGCGTCTTCAGGACTTTGCCACCTACTTC
AGTCCCATTCCGAGCATGGTGGGCGGGGTATCCGATATGTCACCGTATCC
GCACCACTATCCCGGCTACTCCTATCAGGCGAGTCCCTCGAACGGAGCAC
CCGGCACTCCTGCCCAGCATGGTCAGTATGGCAGTGGCGCCAATGCTACC
TTGCACCCACCACCACCACCGCCGCCGCCGCATCACGCTGCCATGTTGCA
TCACCCGAATGCCGCCTTGGGCGACATCTGCCCCACCGGGCAGCCCCACT
ACGGGCACAATCTGGGATCCCCCCCTCCCCTTCAGCATGCATCTGACCAA
CTCCAGTCACGAGGCCGATGGAGCCGCCCCCTCCCCGCCCCTTTTTTTTT
TTTTGTACCACCACCTGATGTACTACGGGAACCCTCATCGGACATTAACC
ATACTGATGGCTTTATTATCTCCATTTTACCGACGACCATCTCCACTTGA
TTTTTCATGAATGACAGCTTCTGTCGCATGGTTGACAACAGCACTAGCAA
CAACTCCTCGGTTCTGGGCTTGCCCAGCAGTGGACATGTTAGCAACGGCT
CGGTAGCTCGGCACATCAGTATGTGTGTATA

FMO10230.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:03:40
Subject Length Description Subject Range Query Range Score Percent Strand
cnc-RN 4746 CG43286-RN 1293..2201 5..915 3725 94.3 Plus
cnc-RM 4737 CG43286-RM 1284..2192 5..915 3725 94.3 Plus
cnc-RO 6701 CG43286-RO 2416..3324 5..915 3725 94.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:03:38
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 23191889..23192284 678..282 1785 97.2 Minus
3R 32079331 3R 23197286..23197566 285..5 1360 98.9 Minus
3R 32079331 3R 23189030..23189129 915..817 450 99 Minus
3R 32079331 3R 23191710..23191779 801..733 210 90 Minus
Blast to na_te.dros performed on 2014-11-26 17:03:39 has no hits.

FMO10230.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:45 Download gff for FMO10230.5prime
Subject Subject Range Query Range Percent Splice Strand
cnc-RB 840..1758 1..923 93   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:16:07 Download gff for FMO10230.5prime
Subject Subject Range Query Range Percent Splice Strand
cnc-RO 2411..3329 1..923 93   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:45:43 Download gff for FMO10230.5prime
Subject Subject Range Query Range Percent Splice Strand
cnc-RO 2411..3329 1..923 93   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:45:43 Download gff for FMO10230.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 23197287..23197569 1..284 98   Minus
3R 23191841..23192281 285..729 92 <- Minus
3R 23191712..23191783 730..799 88 <- Minus
3R 23189025..23189144 800..923 91 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:16:07 Download gff for FMO10230.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 19023009..19023291 1..284 98   Minus
arm_3R 19017563..19018003 285..729 92 <- Minus
arm_3R 19017434..19017505 730..799 88 <- Minus
arm_3R 19014747..19014866 800..923 91 <- Minus