Clone FMO10234 Report

Search the DGRC for FMO10234

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:34
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG14131-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10234.5prime Sequence

1075 bp (888 high quality bases) assembled on 2010-11-11

> FMO10234.5prime
CAGTCGACATGGCCCAGCTGAAGAATGTGGGCCAAGCAGGTCAACAGGCC
GTTCTTGTTGTTGGCCCCATGCTTGCCTCGGCCATGTTGCTCATGGGGCT
GATATTCGCGCTGCTGGGGATCAAGTTCTTCGGCTTCCGGCGGCGACTGA
CTTTCGAGCGATCGCAGGTGCAGCGGCAACAGCAGAATCAGCAGCAGCAA
CAACCGCCGCCACGTTACGCAGCTTTCGAATCGCAGGTTAACGGCACCGA
TACTGCTGTCCATGGAGTGTTCCGACGTCGCAATCTCGAGGAATTCGAAA
GCCCATGGCCATCGGCATCAGCAACGACAGGGAACAACTTCATCAGTGGC
AGTGTTCCAAATCTGCAACTTATTGGCGCCAGCCCAAGACAGCCCAAATC
CACGGAAGAATCACCAGTTTCCTATCGAGAGAAGTCGGAGGCACAACGAC
CGGAGGTGCACAGTGAGCACTATGAATTCTACACCGCTCCACCTACCCGC
AAGCCACCTTCTCCGCCACTACAATCAGAAGTACTAGCTGAAACTGCCTC
GGTAGTTTCACTACCTAAGATACTAGAATCCATCCCTGCTCCACCTCCCA
GGACCATGAGAGGAGCTGCTGCATCCAAGCCTTCAGGACCTGCAGCTTCT
GTCGACACAGCTCCCGAGCCTCCTATCGAACTGGGAATGCCCAACTTCGA
TCACTTTGCTGAAAAGTACGAGTTGTTTAGTGTAAAACCAACGACTGCGC
CCACTAGACCAACACAGTTGCGAAGTAAGAACAGCGGCCGCTATGTGAAG
TTCGAGCCAGTTGATGATGTGCCGGAATTCTCACTCCTGAGGATCCCGTT
CCGGAGTTACTAACTCCAGATGATGGTTTGGGAGGAGCGATGTCAAATAA
CAGCTGTGGATCATAGGGGAGCCATACCCAAGGAAGAAACGGAATCGAAA
GATGACCGCAAGCACCAATGATACCGATCCCTTTGGGGGACCCAGCATAC
AGACTCAGCTTCCTGTCGTGAAATCATTAGCATGTAGTCCGACGGAGCGA
CCTCTAGCTTACAGCCACTTCAAAT

FMO10234.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:02:48
Subject Length Description Subject Range Query Range Score Percent Strand
CG14131-RA 2532 CG14131-RA 147..1183 6..1040 4805 98.1 Plus
CG14131-RB 2529 CG14131-RB 147..1180 6..1040 4750 97.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:02:44
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 11778422..11779108 328..1011 3040 97.8 Plus
3L 28110227 3L 11777304..11777507 35..238 1020 100 Plus
3L 28110227 3L 11778215..11778312 234..331 490 100 Plus
Blast to na_te.dros performed 2014-11-26 17:02:45
Subject Length Description Subject Range Query Range Score Percent Strand
roo 9092 roo DM_ROO 9092bp 1087..1145 164..223 162 76.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2602..2662 157..217 161 73.8 Plus
roo 9092 roo DM_ROO 9092bp 1104..1151 157..204 150 79.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6778..6821 170..213 148 81.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6805..6851 164..210 145 78.7 Plus
roo 9092 roo DM_ROO 9092bp 1099..1148 164..213 142 76 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6881..6923 165..207 134 79.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2377..2424 157..204 132 75 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1539..1575 171..207 131 83.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2330..2373 164..207 130 77.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6736..6770 170..204 130 85.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6757..6791 170..204 130 85.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1513..1551 166..204 123 79.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2438..2472 170..204 121 82.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2480..2514 170..204 121 82.9 Plus
gypsy11 4428 gypsy11 GYPSY11 4428bp 972..1056 171..255 119 60 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2773..2826 157..210 117 68.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2305..2352 175..223 116 73.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6784..6824 164..204 115 75.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2812..2868 157..213 114 66.7 Plus

FMO10234.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:34 Download gff for FMO10234.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14131-RA 1..1026 9..1032 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:22 Download gff for FMO10234.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14131-RA 141..1175 1..1032 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:45:10 Download gff for FMO10234.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14131-RA 141..1175 1..1032 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:45:10 Download gff for FMO10234.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 11778425..11779128 331..1032 97   Plus
3L 11778218..11778311 237..330 100 -> Plus
3L 11777306..11777505 37..236 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:22 Download gff for FMO10234.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 11771525..11772228 331..1032 97   Plus
arm_3L 11771318..11771411 237..330 100 -> Plus
arm_3L 11770406..11770605 37..236 100 -> Plus