Clone FMO10239 Report

Search the DGRC for FMO10239

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:39
Vector:pMK33-CFH-BD
Associated Gene/Transcript
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10239.5prime Sequence

1077 bp (770 high quality bases) assembled on 2010-11-11

> FMO10239.5prime
CAGTCGACATGTTTTCTTACTGGACCAAACAGAATATATCAAGCTCAGTA
GATGGAAAAAAGATGGACAAAGTTTCTACCATGAGAAAAAAAAATTCAAC
AAAAGTTAAAATGGAGAAAAAAGAAACAGTTGTACCGATTACAGAAATGC
GTGCTCTGGAATTTCAAGATTTCCTTAAGCGGGTACAGACGTTACAAATG
TCGCACAACGAAAGCCGCGATTTAGTCAATGGACCTAATATCTGCAGTTC
CATGGATATTGAAGTCGGCGAAGAACCTCCTACGACATCTTTTGCCGATA
ACATAGATAAAGCGTGTCCTTTACCAGTGCTGCGATCATCTGATTGTGAT
TGTGTGCCACTTTGTATGACAAATATTCGTGTATCAGTTGGTATTGTCAA
AGACTTAGAAATGATTCTTGAAATGGATCCGAGTATTGTAGATTTGGGTG
ATATTAGCATTGATGAAACTGCAGAACCGCGCATAGTGGGCTTACCTCCA
CTTTCGGGTGGACCGACATTTAAAACTGCTACTCCCACTTCACGAACACA
ACTAAAACTGCAGCTACAACGTGAACAACAGCAACAAATGATGATACAAC
AACAGACATTAGACACTGCTATGGACCCAAAAATGCATCTATTGATCGCC
ACATGTGCATGGGCTTATGGAATCGGAATTCATTGACAGCGGTAGTACCA
GTGCTCGCGCGCACAAGGTCATCCAGTTTAGAACAAATGTCACAGTTAGT
GCAAATGGACAATTTAATTGATTCGTCAAGTGGAGCCAAGCTTAAAGTTC
CTCTTCAAAGTATCGGAGTACATGTCCCACCTCAAGTGCTGCATGTCAGT
ACAGTGCTTGAAAACCCTACAAGGTATCACGTTATCCAAAAGCAAAAGAA
TCAAGTGAGGCAATATCTCAGCGAATCCTTTAGCCGTCTATGTGGGGCAG
TCATACCCAGCGAAATAAAATTAGCAAAATAATTCCGCGTCAACCGGGAA
ATCTCAAATTCATCTTTACAGAAAGGTATTTGCGATCATTGGGAGCGTAC
AAACGATTTGGATGCCAATCGCTGGGA

FMO10239.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:03:11
Subject Length Description Subject Range Query Range Score Percent Strand
Mitf-RC 3226 CG43369-RC 54..1109 9..1065 4780 97.4 Plus
Mitf-RB 3009 CG43369-RB 319..871 512..1065 2280 95.2 Plus
Mitf-RA 4032 CG43369-RA 325..877 512..1065 2280 95.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:03:09
Subject Length Description Subject Range Query Range Score Percent Strand
4 1348131 4 1219093..1219595 9..511 2500 99.8 Plus
4 1348131 4 1219693..1220023 511..843 1355 95.2 Plus
4 1348131 4 1220076..1220189 845..957 520 99.1 Plus
4 1348131 4 1220260..1220361 965..1065 230 90.4 Plus
Blast to na_te.dros performed 2014-11-26 17:03:10
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6765..6847 524..605 151 66.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6814 512..605 130 61.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2468..2531 548..612 124 67.7 Plus
Dana\Tom 7060 Dana\Tom DNTOMRETA 7060bp Derived from Z24451 (Rel. 44, Last updated, Version 6). 6171..6256 948..1033 123 63.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2420..2476 542..604 121 71.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2342..2425 522..604 120 61.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2332..2444 524..641 109 59.7 Plus

FMO10239.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:39 Download gff for FMO10239.5prime
Subject Subject Range Query Range Percent Splice Strand
Mitf-RA 319..883 512..1076 94   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:45 Download gff for FMO10239.5prime
Subject Subject Range Query Range Percent Splice Strand
Mitf-RC 49..1121 1..1076 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:45:25 Download gff for FMO10239.5prime
Subject Subject Range Query Range Percent Splice Strand
Mitf-RC 49..1121 1..1076 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:45:25 Download gff for FMO10239.5prime
Subject Subject Range Query Range Percent Splice Strand
4 1220076..1220195 845..964 98 -> Plus
4 1219694..1220024 512..844 94 -> Plus
4 1219088..1219595 1..511 99 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:45 Download gff for FMO10239.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_4 1223802..1223921 845..964 98 -> Plus
arm_4 1223420..1223750 512..844 94 -> Plus
arm_4 1222814..1223321 1..511 99 -> Plus