Clone FMO10241 Report

Search the DGRC for FMO10241

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:41
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG8850-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10241.5prime Sequence

925 bp (672 high quality bases) assembled on 2010-11-11

> FMO10241.5prime
CAGTCGACATGGATGATGATGCAGAATACCAGAAGCTCCGGCGAAACATG
CAGGGAGCTCAAGGATCGAGAGAAGGACATCCAGGATCAAATGATGGCAT
CAGCACAGTAATCTACAGCGCGGAAGGAGAAGAGCTTACCATAAATTGTG
AGGCCGAATCCGAGTCATCCGGCCAGCGAGATCAGTGGAGCAGGGGAGTG
GAGTTCCTCTTCTCCTGCATCGCCCTATCCGTTGGCCTTGGCAATGTCTG
GCGATTTCCGTTCATTGCTCTGGAGAATGGCGGTGGCGCCTTTCTCATAC
CCTACGTGATTGTGCTCCTGCTGATTGGCAGACCGGTTTACTATCTGGAG
GTCATCATTGGTCAGTTCTCGAGCCGTGGTTGCATCAGAGCCTTCGATAT
GGCACCTATAATGAGGGGTATTGCCTATGGTCAGGTGTATTCCACCGCCT
TGGCCACCACCAACTACGCCTGCATTATGGCCTTGACCATCCCATACCCG
GCGGCTACCTTCAGTGAAGTCCTGCCCTGGACATATTGCCTCGTGGAATG
GGGCACAACTTGCGTGGCGACGGGAGCCACAGCTGCCAATGACTCATCCA
TTGTGCAGGGGGTTTCCCCCCCCGACCTGTTTTTCACGCAAACAGTTCTG
AGGGAGCCCGAATCGCTGGACGACACTGCCCCCCCGTATTTCTTTTTGTT
TATCTGGCCCCGTGTCTCCTGGCCACTTGGGTGATCATCGGCACGATCCT
GTCAAAGGGTATTCGCAGTCGGGAAAGCTTCCCCCCTCCTTGTGCTCTTG
TTTCTCTATGTGATCATGATCGTACTGCTCATTCGGGCGGTCACTTTACC
AGGTGCCTGGCAGGAATTGTGTACTTCCTGAAGCCCCAATGGTCCCAGCC
TCCTCCACTCACTCCCCGAGATAAT

FMO10241.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:03:17
Subject Length Description Subject Range Query Range Score Percent Strand
CG8850-RB 2260 CG8850-RB 186..1074 9..899 3685 94.7 Plus
CG8850-RA 2086 CG8850-RA 73..947 23..899 3615 94.7 Plus
CG42700-RJ 4712 CG42700-RJ 4291..4512 638..417 900 93.7 Minus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:03:15
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 12300652..12300938 419..133 1435 100 Minus
2R 25286936 2R 12300374..12300595 638..417 900 93.7 Minus
2R 25286936 2R 12300998..12301123 134..9 630 100 Minus
2R 25286936 2R 12300051..12300310 899..638 610 86.4 Minus
2L 23513712 2L 14848742..14848905 349..186 325 79.9 Minus
2R 25286936 2R 18730015..18730155 350..210 210 76.6 Minus
Blast to na_te.dros performed on 2014-11-26 17:03:16 has no hits.

FMO10241.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:40 Download gff for FMO10241.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8850-RB 112..1009 9..910 94   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:49 Download gff for FMO10241.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8850-RB 186..1083 9..910 94   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:45:28 Download gff for FMO10241.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8850-RB 186..1083 9..910 94   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:45:28 Download gff for FMO10241.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 12300998..12301123 9..134 100   Minus
2R 12300654..12300936 135..417 100 <- Minus
2R 12300375..12300594 418..637 93 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:49 Download gff for FMO10241.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 8188503..8188628 9..134 100   Minus
arm_2R 8188159..8188441 135..417 100 <- Minus
arm_2R 8187880..8188099 418..637 93 <- Minus