Clone FMO10242 Report

Search the DGRC for FMO10242

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:42
Vector:pMK33-CFH-BD
Associated Gene/TranscriptFbp1-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10242.5prime Sequence

755 bp (213 high quality bases) assembled on 2010-11-11

> FMO10242.5prime
CAGTCGACATGAACAGAATCATGCTGTTGGTGGCCTTTGCGGCCGGCGTT
GTGGCTGCTGGAAGGATAACTACGAATCAGGACAGGGTCCAGGGTATTGA
CCGCATGTCCTTGGAGGATCTGCAGCTCCAAAAGTTTATCCTGGATATCG
TCCAGAATATTCGTCAGCCTCTACAGCAGAGTGAGCTCATCAATCTATAT
GTGGGTCTGATTGCAGACAGTCAGCGTTATCGTGGCGGTATTGATAAGGT
GATGCATAACGTCATCGATCTGGATCGCCAGCGTCGCCTCCTCGACGAGC
ACCAGGTGTACTCCGTGGGTCGTTTGGAGCATGTGCAGCAGCTGCGTGGC
ATATACCGCCTGCTGGCTCGCGCCCAGGACTTTGAAACCCTTCGCCGTAA
TGTGGTCTACCTGCGCCGTAACATTAACCCTGTCCTGCTGGTTAATGCCT
TGGCTCTGGCCATTCCCGATAGTGAGGACACTCAAGCTCTGATCGTGCCC
GCTGTCCAGGAGCTGCTCCCCGAACTGTATCTGGATGAGGAAGTGATTCA
GCAGGTGCGCACCCCCCCCCCGGAACAAACCCAGCGCCCATCGCTCATGG
ACATCGTGGGTATGCGCCAGCGGGCTCTCCCCCCCTCCCTTTTTTTTTCC
TGATGCCCTGGAGGGAGATCCACATGCAGATGGCTCTCCCGCCCCCCCCT
CCATTTTTTTTTATTTTTTTTGCCCCCCAACGCGTCGATGTCGTCCAAAG
AAAAA

FMO10242.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:03:19
Subject Length Description Subject Range Query Range Score Percent Strand
Fbp1-RA 3405 CG17285-RA 95..771 9..687 2965 95.9 Plus
Fbp1-RD 3399 CG17285-RD 95..765 9..687 2865 95 Plus
Fbp1-RB 3465 CG17285-RB 245..831 99..687 2515 95.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:03:18
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 14097223..14097809 687..99 2490 95.2 Minus
3L 28110227 3L 14097869..14097959 99..9 455 100 Minus
Blast to na_te.dros performed 2014-11-26 17:03:18
Subject Length Description Subject Range Query Range Score Percent Strand
Burdock 6411 Burdock DMU89994 6411bp Derived from U89994 (g1905850) (Rel. 51, Last updated, Version 1). 1785..1849 556..621 111 65.2 Plus

FMO10242.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:41 Download gff for FMO10242.5prime
Subject Subject Range Query Range Percent Splice Strand
Fbp1-RA 90..774 1..687 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:51 Download gff for FMO10242.5prime
Subject Subject Range Query Range Percent Splice Strand
Fbp1-RA 87..771 1..687 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:45:29 Download gff for FMO10242.5prime
Subject Subject Range Query Range Percent Splice Strand
Fbp1-RA 87..771 1..687 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:45:29 Download gff for FMO10242.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 14097869..14097967 1..99 96   Minus
3L 14097213..14097808 100..697 93 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:51 Download gff for FMO10242.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 14090969..14091067 1..99 96   Minus
arm_3L 14090313..14090908 100..697 93 <- Minus