Clone FMO10243 Report

Search the DGRC for FMO10243

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:43
Vector:pMK33-CFH-BD
Associated Gene/Transcriptine-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10243.5prime Sequence

1002 bp (673 high quality bases) assembled on 2010-11-11

> FMO10243.5prime
CAGTCGACATGCCGAACCGCCAGGACTACGATGCACAGTCCTCGAAGCAC
TCGGAACAGTCCTTCTTCCGCTTCAACCGGGTGGCCAAAGTACCCCTGGG
GGTGGATGACGATGACAGCTACCTGGACATGTCCGATGAGACGGCCCAGC
TCAAGCCGCGCCAGCAGCACTGGGCCAATAAGATGCAATTCGTCCTGGCC
TGCATAGGATACTCGGTGGGTCTGGGCAACGTCTGGCGTTTTCCGTACAT
GTGCTACAAGAGTGGCGGTGGTGTTTTTCTAGTACCTTATTGCATAATAC
TGTTCATATGCAGCATTCCGCTGCTCTTCATGGAGCTGTCCGTTGGCCAA
TACACCGGTCGAGGACCCATTGGAGCACTGGGTCAACTGTGTCCTCTGTT
CAAGGGAGCCGGACTCGCCAGCGTGGTCGTCTCGTTCCTCATGTCCACCT
ACTATCCCGTCATCATAGGCTACTCCATCTACTACTTCTTTACGTCGTTC
AAAACGGAAATGCCCTGGATCGACTGCAACAACAGGTGGAACACGCCCGC
TTGCTGGGTGCCACAGCGCAAGGGGATTAATGCCAGTGCGCCGGACACAT
CTCGCACTCCATCCCACGACTTCTTCAAAAACAAGGTCCTGCAGATCAGC
GGTGGCCTGGAGTATCCCCCCCCCGACCCCCTGTTTATCTATTTGCCTGC
CTGATCTGCGCCTGGCTAATGCTCTACTTCGCCACGTGCAAGTCTATCAA
GTCGTCTGCGAAGTGCGCTACTTCACCGCCCTTTTTCTTTTTTTTGCTGA
TCATCATCCTGATGGTGCGCGCGGTGACCCTGGATGGAGCTGCTGAGGGT
TTGCGCTTCTTCTTCCGTCCCAAGTGGTCGGAGCTGAGAACGCCCACCGT
CCTGTATCACGCCGCATCCCACCACCTTCAACTCGCTGGGCATTACATTC
GGATCCATGATCTTCTTTTGCAGCTACAACAAGTACAACAAACAATATCC
TG

FMO10243.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:03:21
Subject Length Description Subject Range Query Range Score Percent Strand
ine-RA 2272 CG15444-RA 156..1151 3..1002 4150 94.9 Plus
ine-RF 3436 CG15444-RF 1439..2345 92..1002 3720 94.5 Plus
ine-RE 3458 CG15444-RE 1461..2367 92..1002 3720 94.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:03:20
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 4469249..4469618 1002..629 945 87.2 Minus
2L 23513712 2L 4471978..4472158 272..92 905 100 Minus
2L 23513712 2L 4470993..4471129 406..270 685 100 Minus
2L 23513712 2L 4469832..4469966 539..405 630 97.8 Minus
2L 23513712 2L 4472949..4473037 91..3 430 98.9 Minus
2L 23513712 2L 4469677..4469770 626..533 410 95.7 Minus
Blast to na_te.dros performed on 2014-11-26 17:03:21 has no hits.

FMO10243.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:42 Download gff for FMO10243.5prime
Subject Subject Range Query Range Percent Splice Strand
ine-RA 150..1149 1..1002 94   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:54 Download gff for FMO10243.5prime
Subject Subject Range Query Range Percent Splice Strand
ine-RA 152..1151 1..1002 94   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:45:30 Download gff for FMO10243.5prime
Subject Subject Range Query Range Percent Splice Strand
ine-RA 152..1151 1..1002 94   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:45:30 Download gff for FMO10243.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 4472949..4473037 1..91 96   Minus
2L 4471980..4472158 92..270 100 <- Minus
2L 4470994..4471128 271..405 100 <- Minus
2L 4469836..4469965 406..535 97 <- Minus
2L 4469675..4469767 536..628 94 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:54 Download gff for FMO10243.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 4472949..4473037 1..91 96   Minus
arm_2L 4471980..4472158 92..270 100 <- Minus
arm_2L 4470994..4471128 271..405 100 <- Minus
arm_2L 4469836..4469965 406..535 97 <- Minus
arm_2L 4469675..4469767 536..628 94 <- Minus