Clone FMO10247 Report

Search the DGRC for FMO10247

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:47
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG16718-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10247.5prime Sequence

1094 bp (951 high quality bases) assembled on 2010-11-11

> FMO10247.5prime
CAGTCGACATGCTAAATTTAGGCAGTGCCAAAGTTGGCGCTCTGGAGGAG
GCCACCTCACCACCCCCCTTCTCCAAGGACGAGAGCTTCCAGCTGTTGGA
GCGGAGCCCCCACAATCCCGCCATATCACCCACCACCACTGTCCCGCTGG
AGCCCCCCTTCACCACCCCCCTAGCTCCCTTCGACATGGAGCTGATGAAG
CGCCACAATCTCCACGAGCGCTTAACGGGAAAGGAGAGCTTCTGGCGCGG
GCGCGACACTTCGCAGAGATTTCTGGACCAGGAGCAATTATCAGCATCGC
GTGAATCACTCGGTGCCGCCGACAAGAGAGCCCGGTTTGCAGAAAGCAAC
GCCCCCACGCTCCAACTGCCAGAATCTGCCGAGCCCAGGGCCAATGGCAA
AAGACCCACTGGGAACAGGACCAACCCATCGAATCCAGCCGCTCCCCTTC
TGCCAATGACTGATCCGGATTTTGTGAAGGGCAATGTAGGCGGCGTCTAC
GATGATCGCGAGTGCAGCTGCCCCAGGGAGTTCTACCAGCGGGGCGAGAT
TAACACATCACTGTTCTTTGAGGACTGCGTCCGGTCCATTGACTTTGTCC
TGGCCTACAGGATCAATGCGCACGAGCCCACGGAGCTGGAGAACACGGAA
AAGCGTCGTGTTTTCGAGGCGAATCTCATTAGTCAGGGGCTGGAGGTCGA
GTCCAGTCAGAAGGACCAGATCTGGTTCGTTAAGATCCACGCTCCTTTGG
AGGTCCTGCGACGGTATGCGGAAATTCTTATGCTGCGCATGCCCATGAAG
GAGATTCCAGGAATGTCCGTGGTCAATCGATCGACCAAAAGCGTGTTTTC
TAGTCTTAAACATGTTTTCCAATTCTTTCTGCGCAACATCTATGTGGTTT
TTTGTATAATTTTTCCCAAAGCGAGCTCATCGATTCACTGCCATTTACAG
TCGCGATAAGGAGTATCTCTTTGACATCCGACAGATTGTTTCTTTACACC
GCCGTCCGTCCCGCATCGATTGAGTTCATTCTAGAATCGCAGCGATTTCC
TGCCAGATCAACATGACTGCTCGTATTGGACGACTGAATGCCAG

FMO10247.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:03:00
Subject Length Description Subject Range Query Range Score Percent Strand
subdued-RA 4046 CG16718-RA 308..1366 9..1067 4915 98.1 Plus
subdued-RD 4118 CG16718-RD 308..1102 9..803 3960 99.9 Plus
subdued-RB 3531 CG16718-RB 129..851 345..1067 3235 97.3 Plus
subdued-RD 4118 CG16718-RD 1173..1438 802..1067 965 93 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:02:59
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 19639026..19639415 734..345 1950 100 Minus
3R 32079331 3R 19642078..19642415 346..9 1690 100 Minus
3R 32079331 3R 19638267..19638429 968..802 620 92.8 Minus
3R 32079331 3R 19638901..19638971 803..733 340 98.6 Minus
Blast to na_te.dros performed on 2014-11-26 17:03:00 has no hits.

FMO10247.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:37 Download gff for FMO10247.5prime
Subject Subject Range Query Range Percent Splice Strand
CG16718-RA 330..1388 9..1067 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:15:34 Download gff for FMO10247.5prime
Subject Subject Range Query Range Percent Splice Strand
CG16718-RA 308..1366 9..1067 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:45:18 Download gff for FMO10247.5prime
Subject Subject Range Query Range Percent Splice Strand
subdued-RA 308..1366 9..1067 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:45:18 Download gff for FMO10247.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 19642078..19642415 9..346 100   Minus
3R 19639026..19639413 347..734 100 <- Minus
3R 19638901..19638969 735..803 98 <- Minus
3R 19638267..19638427 804..968 93 <- Minus
3R 19638092..19638194 969..1067 91 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:15:34 Download gff for FMO10247.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 15467800..15468137 9..346 100   Minus
arm_3R 15464748..15465135 347..734 100 <- Minus
arm_3R 15464623..15464691 735..803 98 <- Minus
arm_3R 15463989..15464149 804..968 93 <- Minus
arm_3R 15463814..15463916 969..1067 91 <- Minus