Clone FMO10250 Report

Search the DGRC for FMO10250

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:50
Vector:pMK33-CFH-BD
Associated Gene/Transcriptcora-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10250.5prime Sequence

1079 bp (939 high quality bases) assembled on 2010-11-11

> FMO10250.5prime
CAGTCGACATGCCGGCGGAAATTAAACCATCCGCGCCCGCTGAGCCGGAA
ACGCCGACCAAGAGCAAACCCAAGTCCAGCTCATCCTCGCACGGAAAGCC
TGCCCTAGCACGAGTCACCCTGCTGGATGGCTCCCTTCTGGACGTGTCCA
TTGATCGCAAAGCCATTGGCCGTGATGTGATCAACTCAATCTGCGCCGGT
CTGAACCTCATCGAAAAGGACTACTTTGGTCTGACCTATGAGACGCCCAC
AGATCCGCGCACTTGGCTGGATCTGGAGAAGCCGGTATCCAAGTTCTTCC
GCACGGACACTTGGCCTCTCACCTTCGCCGTCAAGTTCTATCCGCCGGAG
CCATCGCAGCTGAAGGAGGACATCACGCGCTACCATTTGTGCCTGCAGGT
GCGCAATGACATCCTGGAGGGTCGACTGCCCTGCACATTCGTCACCCACG
CTCTGCTCGGATCCTACTTGGTGCAGTCGGAGATGGGCGACTACGATGCA
GAGGAAATGCCCACCAGGGCCTACCTGAAGGACTTCAAGATCGCTCCAAA
TCAGACGGCTGAGTTGGAGGATAAGGTCATGGATCTTCACAAGACCCACA
AGGGACAATCGCCCGCCGAGGCTGAGCTACACTACCTGCAGAATGCCAAG
AAGCTGGCCATGTACGGCGTGGACTTGCATCCCGCTAAGGATTCTGAGGG
CCTGGACATCATGCTGGGCGTTTGTGCCTCCGGTTTGCTCGTCTACCGCG
CTAAATTGCGCATCAACCGCTTTGCCTGGCCCAAGATTCTGAAGATCTCC
TACAAGCACCTCCCATTTCTACATCAAGATCCGACCGGGTGAATTCGAGC
AGTACGAATCCACCATTGGCTTTAAGCTGGCCAACCATCGTGCCGCCAAG
AAACTGTGGAAATCCTGCGTGCAGCACCACCACCTTCTTCCTTCCTGATG
ATCCCTCGAACCGGTCAGCAGTCCAGATGTTCCCAGTCTTCGGTCCACCT
ATCGCTACAAGGGTTCGCACTCAAGCCGAGAGCCGGAACCACCCGTGGAA
TCGTATCCTCGAAGTTTCATAAGAACTCT

FMO10250.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:59:57
Subject Length Description Subject Range Query Range Score Percent Strand
cora-RG 5893 CG11949-RG 372..1429 9..1066 4855 97.8 Plus
cora-RF 5605 CG11949-RF 372..1429 9..1066 4855 97.8 Plus
cora-RE 2902 CG11949-RE 372..1429 9..1066 4855 97.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:59:55
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 19235763..19236209 156..602 2235 100 Plus
2R 25286936 2R 19236481..19236778 751..1049 930 94.1 Plus
2R 25286936 2R 19235516..19235662 9..155 735 100 Plus
2R 25286936 2R 19236267..19236419 602..754 720 98 Plus
Blast to na_te.dros performed on 2014-11-26 16:59:56 has no hits.

FMO10250.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:00 Download gff for FMO10250.5prime
Subject Subject Range Query Range Percent Splice Strand
cora-RA 361..1435 1..1074 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:13:22 Download gff for FMO10250.5prime
Subject Subject Range Query Range Percent Splice Strand
cora-RE 363..1437 1..1074 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:43:32 Download gff for FMO10250.5prime
Subject Subject Range Query Range Percent Splice Strand
cora-RE 363..1437 1..1074 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:43:32 Download gff for FMO10250.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 19236485..19236752 755..1025 94 -> Plus
2R 19236267..19236419 602..754 98 -> Plus
2R 19235763..19236208 156..601 100 -> Plus
2R 19235507..19235662 1..155 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:13:22 Download gff for FMO10250.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 15123990..15124257 755..1025 94 -> Plus
arm_2R 15123772..15123924 602..754 98 -> Plus
arm_2R 15123268..15123713 156..601 100 -> Plus
arm_2R 15123012..15123167 1..155 97 -> Plus