Clone FMO10252 Report

Search the DGRC for FMO10252

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:52
Vector:pMK33-CFH-BD
Associated Gene/TranscriptIswi-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10252.5prime Sequence

993 bp (683 high quality bases) assembled on 2010-11-11

> FMO10252.5prime
CAGTCGACATGTCCAAAACAGATACAGCTGCCGTGGAGGCAACCGAAGAG
AACTCGAACGAGACGACTTCAGATGCGGCCACCAGTTCATCCGGTGAAAA
GGAGGCTGAGTTCGACAACAAAATCGAGGCTGATCGCAGTAGGCGCTTTG
ATTTCCTGCTAAAGCAGACGGAGATATTCACCCACTTCATGACTAACAGC
GCTAAGAGTCCCACGAACCCTAAGGGTAAACCCAAGAAAATCAAAGACAA
GGACAAGGAAAAGGATGTGGCCGATCATCGTCATCGCAAGACAGAGCAGG
AGGAGGATGAGGAGTTGCTGGCGGAAGACTCGGCCACCAAGGAGATCTTT
CGCTTCGATGCCTCACCCGCCTACATCAAAAGTGGAGAGATGCGTGACTA
CCAGATTCGCGGTCTTAACTGGATGATTTCGCTTTACGAAAATGGTATCA
ATGGAATTCTGGCCGCTGAAATGGGTCTAGGAAAGACCCTGCAGACCATA
TCCCTGCTGGGTTACCTCAAGCATTTCAAAAATCAAGCTGGACCACACAT
CGTCATCCCCCCCCAAGTCAACGCTTCAGAATTGGGTAAATGAGTTTAAA
AAGTGGTGTCCTTCCCTCAGAGCCGTCCGCCCTTATTGTTGACCAGGACA
CCCGTAACACCTTCATTAGAGATGTGCTCATGCCTGGCCACCGCCACGTT
TGCGTGACCTCCTATGACATGTGTATCCGCGAGAAGTCTGTATTCAAGAA
GTTCAACTGGCGCTATTTGGTCATCGACGAGGCGCATCGTATCCCCACCA
CAAAGTCGAATCTGTCCGAGACTCTGCGAGAGTTTAAGACCGCTAATCGT
CTACTTATCACGGGTACTCCGCTGCAGAATAACCTCCACGAGCTGTGGCC
CTGCTTAACTTCCTGCTGCCCCGACGCAGCTCAATACGATCAGAGGATAA
CGACGATGTCAACACGACACCTGCTGGGTGACGATGCATTGAT

FMO10252.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:00:00
Subject Length Description Subject Range Query Range Score Percent Strand
Iswi-RC 3585 CG8625-RC 211..1196 9..993 4150 95.3 Plus
Iswi-RB 3541 CG8625-RB 167..1152 9..993 4150 95.3 Plus
Iswi-RA 3647 CG8625-RA 273..1258 9..993 4150 95.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:59:58
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 12637655..12638045 530..921 1470 93.4 Plus
2R 25286936 2R 12637339..12637593 275..529 1245 99.2 Plus
2R 25286936 2R 12637053..12637271 56..274 1050 98.6 Plus
2R 25286936 2R 12636943..12636990 9..56 240 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:59:59 has no hits.

FMO10252.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:00 Download gff for FMO10252.5prime
Subject Subject Range Query Range Percent Splice Strand
Iswi-RC 161..1072 9..921 96 == Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:13:24 Download gff for FMO10252.5prime
Subject Subject Range Query Range Percent Splice Strand
Iswi-RA 273..1184 9..921 96 == Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:43:34 Download gff for FMO10252.5prime
Subject Subject Range Query Range Percent Splice Strand
Iswi-RA 273..1184 9..921 96 == Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:43:34 Download gff for FMO10252.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 12637655..12638045 530..921 93 == Plus
2R 12637339..12637593 275..529 99 -> Plus
2R 12637054..12637271 57..274 98 -> Plus
2R 12636943..12636990 9..56 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:13:24 Download gff for FMO10252.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 8525160..8525550 530..921 93 == Plus
arm_2R 8524844..8525098 275..529 99 -> Plus
arm_2R 8524559..8524776 57..274 98 -> Plus
arm_2R 8524448..8524495 9..56 100 -> Plus