Clone FMO10254 Report

Search the DGRC for FMO10254

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:54
Vector:pMK33-CFH-BD
Associated Gene/Transcriptwech-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10254.5prime Sequence

1028 bp (685 high quality bases) assembled on 2010-11-11

> FMO10254.5prime
CAGTCGACATGATGGAACTTTTGTCAAACAATTCGGTTCCGCAACAAATG
GCCAGCAGCAATGCGCCGAGCGCCAACAATGTGGCCCACTCCTCAACGGC
CAACGGAAGTGGAGGCGGCAGTGTGAGCAGCAATGCCAGCAACTCCTCCG
AGCGACTGCTGGCGGGCATCCTGGAGAGCTTTCCCGCCTGGGACCTCAAC
GTGGGACTACTGCCCAACGTGGGCCAGAGCTCACCACCACGCGCAGACTT
CTTTATCAATAACTTCCTGGGCGGCCTGGACACGCATGGCGACTTCAGCA
TTGGACCCATTGGCAGCGGTGCCCGCAGCAATCCGAAGATGTCGCCAGAG
TCATCTAACAACTCGAGCATCAGCTGCGGTTGGTGCGAGGTTAGTGCTTC
AATACGCTGCCTGGAGTGCAACGAGTTCATGTGCAACGACTGCCTAAGGG
CACATCGCAACAGTCCGCTGTCCTCCAACCACTCGATCGCGTCCTTGCCC
ACGCCCATTGGAGCCTCGCCCACGGGTGGCAGCTCGGTAAATGCACACAC
TCCGCCCAGCGGCAACTTTATCTGCGACATACACAACGAGATGTTGCGCT
ACGTACCCGACCACTGCCGGAAATTGGTGTGTCAGTGCTGCACACTGCAC
GAGCACAAGGACCCCCCCCCCCTTTTCTATTTTTAGCTTTATGGTGGGCT
CGAAGGAGAAGCTGGAGGGCGCCATTGAGAGCAGCCAGGTGGGCACGCGC
TGCATTAAGAGCAGCATTCACCAAGCGTTGTTTTTTCATCCGGCTTATCG
AGCGCAATTGCAGCGAGCTGAGCGATAATATACGCAAGGCATTCCGTCAG
TTTATCATTGCCATCGAGGACCGCGAGCGTCTCCTCCCCGCACTTTGTGT
ATATTGCTTCTGCCAGCGTCGTCTGGGCCATCCTACACGATCAGATGGCA
AGCTTAAAGGTCTGCTCTCGCCGGGACTCTCCGAAACGTCCGATCTGCCT
TAGCAAGGTGGCCGAACATGCCTGCACA

FMO10254.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:00:06
Subject Length Description Subject Range Query Range Score Percent Strand
wech-RE 4316 CG42396-RE 300..1308 9..1026 4280 95.3 Plus
wech-RD 6021 CG42396-RD 224..1232 9..1026 4280 95.3 Plus
wech-RC 7593 CG42396-RC 554..1562 9..1026 4280 95.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:00:04
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 7485028..7485817 1026..228 2965 93.7 Minus
2R 25286936 2R 7485885..7486105 229..9 1105 100 Minus
Blast to na_te.dros performed 2014-11-26 17:00:04
Subject Length Description Subject Range Query Range Score Percent Strand
X-element 4740 X-element ROXELEMENT 4740bp 577..654 862..785 111 63.7 Minus

FMO10254.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:02 Download gff for FMO10254.5prime
Subject Subject Range Query Range Percent Splice Strand
wech-RC 338..1353 1..1027 94   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:13:28 Download gff for FMO10254.5prime
Subject Subject Range Query Range Percent Splice Strand
wech-RC 547..1562 1..1027 94   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:43:37 Download gff for FMO10254.5prime
Subject Subject Range Query Range Percent Splice Strand
wech-RC 547..1562 1..1027 94   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:43:37 Download gff for FMO10254.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 7485885..7486112 1..229 98   Minus
2R 7485026..7485815 230..1027 93 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:13:28 Download gff for FMO10254.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 3373390..3373617 1..229 98   Minus
arm_2R 3372531..3373320 230..1027 93 <- Minus