Clone FMO10255 Report

Search the DGRC for FMO10255

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:55
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG31708-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10255.5prime Sequence

788 bp (550 high quality bases) assembled on 2010-11-11

> FMO10255.5prime
CAGTCGACATGTTGCCCCCGTCCTGGCATCTAATTGGGGCCCTCCTAGTG
CTCGCGGCAACAGCGGGGGACTCCACCAACAAGATCATCTTGCCGCAGAT
TCTAAACGGTGGCGGTGGCGGCGGGGGCGTCGGAACTGCCCAGGGCAAAC
ATCCGTCTGGATCCAAGACGGTGGCAACTGGAGTGGTTCCAAACTTCGGT
GGAGCAGCTGGCAATGGAGCGGGCGGAGGAGGACCTGTGGCTGGCAGCGG
AACCGGAAGCACCGTGGTCGGCAGCAATGGCGTGATTGTGGCCGGAGGCG
GGGCCAATGTGCCGACCTCGAATTTAAACATTGTCGTCGAAGAACCCGAA
TTTACTGAATACATCGAAAACGTAACTGTACCTGCTGGACGTAATGTTAA
ACTCGGTTGCTCCGTGAAAAATCTGGGCTCATATAAGGTCGCCTGGATGC
ACTTCCAACCCCCCGCCATCCTGACCGTTCACAATCACGTGACCCCCCCC
CATCCGCGCATCAGTGTCACGCACGACAAGCACGACAGGCACCGCACGTG
CCCCCCCGCCCCTAAACAATGTGCACGAGGAGGACCGGGGTCGATATATG
TGCCAGATCAATACGGTCACCCCCTCATATTTAATTCTGGCTACCTAAAC
GTTGTCGTTCCCCCCAACATCGACCACCCCCCCCCCCCTTTTTTATTTTA
TTTTTCCCACACGGAGCCAACATTTCGCTGAGATGCCGGGTAGCGGTAGT
TTTTTTATTTTTTATTTTATGGAGCGCGACGACCCCCC

FMO10255.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:00:09
Subject Length Description Subject Range Query Range Score Percent Strand
CG31708-RC 3384 CG31708-RC 575..1237 9..674 2850 95.5 Plus
CG31708-RB 3562 CG31708-RB 693..1355 9..674 2850 95.5 Plus
CG31708-RA 3444 CG31708-RA 575..1237 9..674 2850 95.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:00:07
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 9066080..9066401 330..9 1610 100 Minus
2L 23513712 2L 9060748..9060928 617..436 590 89.6 Minus
2L 23513712 2L 9062398..9062506 439..331 545 100 Minus
Blast to na_te.dros performed on 2014-11-26 17:00:08 has no hits.

FMO10255.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:02 Download gff for FMO10255.5prime
Subject Subject Range Query Range Percent Splice Strand
CG31708-RB 684..1428 1..750 92   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:13:31 Download gff for FMO10255.5prime
Subject Subject Range Query Range Percent Splice Strand
CG31708-RA 568..1312 1..750 92   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:43:39 Download gff for FMO10255.5prime
Subject Subject Range Query Range Percent Splice Strand
CG31708-RA 568..1312 1..750 92   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:43:39 Download gff for FMO10255.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 9066080..9066406 1..330 98   Minus
2L 9062400..9062506 331..437 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:13:31 Download gff for FMO10255.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 9066080..9066406 1..330 98   Minus
arm_2L 9062400..9062506 331..437 100 <- Minus