Clone FMO10256 Report

Search the DGRC for FMO10256

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:56
Vector:pMK33-CFH-BD
Associated Gene/TranscriptZasp52-RE
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10256.5prime Sequence

964 bp (711 high quality bases) assembled on 2010-11-11

> FMO10256.5prime
CAGTCGACATGGCCCAACCACAGCTGCTGCAAATCAAATTGTCACGTTTC
GATGCCCAACCCTGGGGATTCCGCCTTCAGGGGGGCACGGACTTCGCTCA
GCCCCTGCTGGTGCAAAAGGTGAACGCCGGCAGCTTGTCCGAGCAGGCTG
GCCTCCAGCCCGGCGATGCGGTGGTCAAGATCAATGACGTGGATGTCTTC
AATCTGCGTCACAAGGATGCCCAGGACATTGTGGTGCGCTCCGGCAACAA
CTTTGTCATCACAGTGCAGCGCGGTGGCTCCACCTGGCGCCCGCATGTGA
CACCGACTGGCAATGTGCCGCAGCCCAACTCGCCGTATCTGCAGACGGTG
ACGAAGACCTCTCTGGCTCACAAACAACAGGACAGCCAGCACATCGGCTG
TGGCTACAACAACGCGGCCCGTCCCTTCTCCAACGGCGGCGATGGCGGCG
TGAAGAGCATTGTCAATAAACAATACAACACCCCGCCTGGCATTTACAGC
GATGAATCTATTGCGGAAACACTCTCGGCCCACGCGGAGGTTTTGGCTGG
CGGTGTGCTCGGCGTCAACTTCAAGAAGAACGACAAGGCATACCAGGGCG
ATCGCTCCGAGGTTCTGAAGTTCCTGCGCGAGGAGGAGACCGGCCAGTCC
CACCCCCCAACCACACAGTCCCGCCAACTTCTACTGGACACAGAGCCACG
CAATCGGCGGCCACCCCCGACCCACTCCACTGCACCACCAGCACCACCAG
CCTCAGCAGGATGAGCGGATTGGTGTACCATTGCAGTCAAATACACTGGC
GCCTGATGCGACCCAGGCCCAGCTTGCCCGCGTCCCCGAAAGATAACGAG
GACCACGCCACACACGATCAGCACGAGCAGCCCGATCCGCGCATCATTGT
GCTGCCCATCTGCCCCGGGCCTCCAGGGGCCCGAGTATAAGCTGAAATGC
CGCTGCACCCGCCG

FMO10256.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:00:12
Subject Length Description Subject Range Query Range Score Percent Strand
Zasp52-RV 3701 CG37-RV 206..1147 9..949 4220 96.8 Plus
Zasp52-RO 1963 CG37-RO 206..1147 9..949 4220 96.8 Plus
Zasp52-RN 4637 CG37-RN 206..1147 9..949 4220 96.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:00:10
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 15779375..15779658 941..659 1040 92.6 Minus
2R 25286936 2R 15783088..15783245 428..271 790 100 Minus
2R 25286936 2R 15783315..15783468 271..118 770 100 Minus
2R 25286936 2R 15781773..15781906 562..429 625 97.8 Minus
2R 25286936 2R 15803359..15803471 121..9 565 100 Minus
2R 25286936 2R 15780992..15781080 650..562 415 97.8 Minus
Blast to na_te.dros performed on 2014-11-26 17:00:11 has no hits.

FMO10256.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:03 Download gff for FMO10256.5prime
Subject Subject Range Query Range Percent Splice Strand
Zasp-RE 197..1157 2..962 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:13:32 Download gff for FMO10256.5prime
Subject Subject Range Query Range Percent Splice Strand
Zasp52-RN 201..1161 2..962 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:43:40 Download gff for FMO10256.5prime
Subject Subject Range Query Range Percent Splice Strand
Zasp52-RN 201..1161 2..962 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:43:40 Download gff for FMO10256.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 15803361..15803476 2..119 96   Minus
2R 15783315..15783466 120..271 100 <- Minus
2R 15783088..15783244 272..428 100 <- Minus
2R 15781773..15781906 429..562 97 <- Minus
2R 15780985..15781079 563..658 93 <- Minus
2R 15779352..15779658 659..962 91 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:13:32 Download gff for FMO10256.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 11690866..11690981 2..119 96   Minus
arm_2R 11670820..11670971 120..271 100 <- Minus
arm_2R 11670593..11670749 272..428 100 <- Minus
arm_2R 11669278..11669411 429..562 97 <- Minus
arm_2R 11668490..11668584 563..658 93 <- Minus
arm_2R 11666857..11667163 659..962 91 <- Minus