Clone FMO10257 Report

Search the DGRC for FMO10257

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:57
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG6254-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10257.5prime Sequence

1038 bp (686 high quality bases) assembled on 2010-11-11

> FMO10257.5prime
CAGTCGACATGTCGGATATTCTCGCAGAAACACAAGCCGCGAACAGAGAT
TCAACAATTTGGCACCAATGGTGTCGCCTGTGCTCCAAGGAGCATCCGAC
AAATCAAAATGTATTCTTCAGGGAGGCGAAACAAAACTCCTGGGCGAGCA
CAATGGCCATGACCATTGGCAAGTACTTTTGGGTCGATATCAAAAGGGAG
GACGAGCTGAGCAATTTTCTGTGCTCCGAATGCTTCACATTGATGGACTG
CCTCATCGAGTTTTCGGAGAGGGTTCGCAAAGTGCAGATCCTTTTCAGCA
AATTGCAGTTGTTACAGTCTAATAATTTGATGGATTATGAGAAAATTCGA
GAGGACTGCGGTGTGGCAACCGATGGATGGAAGCATATAATGCTCGGAGC
CGTAGACGAAAGTCTTCCCCAGAATGACGAAGTATTCATCAGCGAGGAAC
AACCAATAGTCTCACAAACAGAAACATCCAGTAAAATGAAAAGTGAAATC
CTAATGATACCAAATTTTTTGGTGGAAAAACAATGTCTTCAGGAAAAACA
AGACTTTCCTAAAGAGGAAGATGTTATTGAAGAAGAAATGCAAATTTCTG
GGGTGGAAGAGGAAATCCTAGAACACCATGTGGAAGAAGATCTTGCCGAG
GAAGAGGTTGACACTGTGGAGGAAGAGATTGACACTGTTGTTTTATTTTT
TTTGAAGCTGTGGAGGAAGAGTTGGAAACCCCCGACGCTACAGATTGCTT
AGTGGAGGAATTGGAGCACATGACAGAGGATCGCTATATCCACGAATTTT
TATATTATATAAGAAAGCCAAGTTTCAGATTTCAACATGGAAACATATGA
AATAGTACAACACAATCCGCAAAAAGAACCCGTAGAAACAAAGACACCGT
GCATCTATCCCACCCACCAGAGGAAACCAAGGAAGATCTCTCCCGAGAGC
ATGTAACCGATGGAGGAGGATGAAATATCAGAGGTACCAGCCCATGTATA
AGTGGCATATTTGCCAAAAGGCCGGTATCAGGAACCCC

FMO10257.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:00:15
Subject Length Description Subject Range Query Range Score Percent Strand
CG6254-RA 2006 CG6254-RA 71..1093 9..1037 4300 95.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:00:13
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 10160199..10161026 1020..189 3220 94.4 Minus
3R 32079331 3R 10161082..10161261 188..9 900 100 Minus
Blast to na_te.dros performed on 2014-11-26 17:00:14 has no hits.

FMO10257.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:04 Download gff for FMO10257.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6254-RA 68..1090 9..1037 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:13:34 Download gff for FMO10257.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6254-RA 71..1093 9..1037 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:43:43 Download gff for FMO10257.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6254-RA 71..1093 9..1037 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:43:43 Download gff for FMO10257.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 10161082..10161261 9..188 100   Minus
3R 10160184..10161026 189..1037 94 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:13:34 Download gff for FMO10257.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 5986804..5986983 9..188 100   Minus
arm_3R 5985906..5986748 189..1037 94 <- Minus