Clone FMO10258 Report

Search the DGRC for FMO10258

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:58
Vector:pMK33-CFH-BD
Associated Gene/Transcriptmtt-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10258.5prime Sequence

1011 bp (598 high quality bases) assembled on 2010-11-11

> FMO10258.5prime
CAGTCGACATGCGGGCGGTGCGCCGGGCGAATGCAACTGGTTCCTTCTCC
TGGATCGGATCCGATGGCTGGAGTGCCCGGAATTTGGTGTCCGACGACTA
CGAGCCGGAGGTGGAAGGCACGCTGTCTGTGCAGCCGCAGGCGAATCCGG
TGCGCGGGTTCGAGGAGTACTTCCTCAGTCTGACGGTGGAGAACAATCAA
CGCAATCCCTGGTTTGTGGAATTCTGGGAGGATCACTTTCAGTGCCGATA
TCCCGGCAGTACGAGCACTCCGTACAATAACTACACCAAACAGTGCACCA
CAAAGGAGCGACTTTCACGCCAGAACACTGACTTCGAGGACCAGTTGCAG
TTTGTCAGCGATGCGGTGATGGCATTTGCATACGCCCTAAGGGATATGCA
CCGCGACCTGTGCGGCGGAGGTCCTTCTCTCTGCGAGGCCACATCCCCAA
CGAAGGGTGCAGACTTGCTGAAATATTTGCGAAAAGTGGAGTTTGAGGGC
CTCAGCGGCGACGAGTTCCGCTTCGACGGGAACGGCGACGGTCCCGCCCG
GTACAACATCATCCACTTCAAGCAGTCCCAGGCGGGACAGTACCCCCCCC
CTCCAAAGTGGGCGAGTACACCGAGGGCGAGCTGCGGCTTAATATGACGG
ACGCCCCCCCTTATTATTTTATTTCTAAGCCGCCGGAGTCTGTCTGCAGC
CTGCCATGTCTTGTGGGTCATGCCAATAATTACTTGTACGGCGAGAGCTG
CTGCCGCCATATGTTTCATATTGCACAACCTATCAAATCCGCCCCCCCGG
ATGACGAGACCCATTGCAAGCTGTGCAAGCTGGGCACTCTTCCCGACGCC
CACAGCAGTACTGCCCCCCCCATCTCGTATTATATATTAATCCACCCGGA
GTCCGCTTGGGCATCGGGTGCTATGGCGTTCAGTGCGACCGGGATCTTAG
TAACGCTCTTCGTAATGGGCGTATTTGTCAGGCCCCACCGACCACCCTCC
ATAGTGCTGTG

FMO10258.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:00:18
Subject Length Description Subject Range Query Range Score Percent Strand
mtt-RG 7328 CG30361-RG 3527..4493 9..983 3860 93.8 Plus
mtt-RF 5422 CG30361-RF 1621..2587 9..983 3860 93.8 Plus
mtt-RE 6368 CG30361-RE 2567..3533 9..983 3860 93.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:00:16
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 8482855..8483028 392..219 870 100 Minus
2R 25286936 2R 8481948..8482098 650..498 595 94.1 Minus
2R 25286936 2R 8481216..8481399 982..796 560 91.5 Minus
2R 25286936 2R 8483132..8483242 219..109 555 100 Minus
2R 25286936 2R 8483601..8483704 112..9 520 100 Minus
2R 25286936 2R 8482605..8482718 499..386 465 93.9 Minus
2R 25286936 2R 8481675..8481751 753..677 295 92.2 Minus
Blast to na_te.dros performed on 2014-11-26 17:00:17 has no hits.

FMO10258.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:04 Download gff for FMO10258.5prime
Subject Subject Range Query Range Percent Splice Strand
mXr-RE 2182..3164 1..995 93   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:13:35 Download gff for FMO10258.5prime
Subject Subject Range Query Range Percent Splice Strand
mtt-RE 2561..3543 1..995 93   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:43:44 Download gff for FMO10258.5prime
Subject Subject Range Query Range Percent Splice Strand
mtt-RE 2561..3543 1..995 93   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:43:44 Download gff for FMO10258.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 8483603..8483708 1..110 96   Minus
2R 8483132..8483240 111..219 100 <- Minus
2R 8482856..8483027 220..391 100 <- Minus
2R 8482606..8482712 392..498 94 <- Minus
2R 8481948..8482097 499..650 94 <- Minus
2R 8481644..8481751 677..786 88 == Minus
2R 8481216..8481407 787..982 91 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:13:35 Download gff for FMO10258.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 4371108..4371213 1..110 96   Minus
arm_2R 4370637..4370745 111..219 100 <- Minus
arm_2R 4370361..4370532 220..391 100 <- Minus
arm_2R 4370111..4370217 392..498 94 <- Minus
arm_2R 4369453..4369602 499..650 94 <- Minus
arm_2R 4369149..4369256 677..786 88 == Minus
arm_2R 4368721..4368912 787..982 91 <- Minus