Clone FMO10260 Report

Search the DGRC for FMO10260

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:60
Vector:pMK33-CFH-BD
Associated Gene/Transcriptesn-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10260.5prime Sequence

694 bp (436 high quality bases) assembled on 2010-11-11

> FMO10260.5prime
CAGTCGACATGCAGCAGGCCCCGCAGCAGCAGCAGCATCCCCATCCGCCC
AGCAGCAGCTACTACACGCAAACCGAAAGCGAGCTGCTCCAGATTGAGGC
GGGCGGCACGGGCCTGACCTTCGCCTCCCACTCGCAACGTCCCGAATCGG
CGATCAGTCAGGTGGCATCCACCGCCCACCTGGACGTGCCCTCGGCCGCC
TCCAGCGGCAGCGGGGGCAGTGCAGTCAGTGGGGGAAGCGGCGGAGCTCC
GGAATCCGCGGGTCGATTTGTGTCCCCGCTGCAGCGCCGCCACTGCCAGC
CGCCCAGCCACCTGCCGCTGAACTCGGTGGCCTCCCCGCTCCGCACCGCC
AGCTACAAGTCGGCGGTTTTTTGTCGCTGGTCATGGCTTCCACCACAGCC
ATCACCAGCAGCTGGACTTCCAGCGGAACTCGCAGTCTGGACGACGACAG
CGGCTGTGCCCTCGAGGAGTACACTTGGGTGCCGCCGGGTCTGCGGCCCG
ATCAGGTCCGTTTGTACTTCAGTCAACTGCCAGACGACAAGTGCCCTACG
TCAACAGTCCCGGCGAAAGTATCGTGTCAAGCAGTTGCTGCACCAGCTTG
CTCCTCATATAGATAACGAAGTGCGCTACTGCCACTCGCTGAGCGACGAG
GAGCCCCACGACTTGTTTATTTTTTTTGTTCAAAGAAGCGGGAG

FMO10260.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:00:23
Subject Length Description Subject Range Query Range Score Percent Strand
esn-RD 3982 CG43722-RD 582..1226 7..654 2945 97.4 Plus
esn-RC 4708 CG43722-RC 1308..1952 7..654 2945 97.4 Plus
esn-RA 3982 CG43722-RA 582..1226 7..654 2945 97.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:00:22
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 7118479..7118977 7..507 2315 98.4 Plus
2R 25286936 2R 7119803..7119900 503..598 390 98 Plus
2R 25286936 2R 7209477..7209570 413..507 230 85.3 Plus
Blast to na_te.dros performed on 2014-11-26 17:00:22 has no hits.

FMO10260.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:05 Download gff for FMO10260.5prime
Subject Subject Range Query Range Percent Splice Strand
esn-RA 576..1233 1..661 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:13:39 Download gff for FMO10260.5prime
Subject Subject Range Query Range Percent Splice Strand
esn-RA 576..1233 1..661 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:43:47 Download gff for FMO10260.5prime
Subject Subject Range Query Range Percent Splice Strand
esn-RA 576..1233 1..661 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:43:47 Download gff for FMO10260.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 7120524..7120564 621..661 92   Plus
2R 7119806..7119919 506..620 92 -> Plus
2R 7118473..7118975 1..505 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:13:39 Download gff for FMO10260.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 3008029..3008069 621..661 92   Plus
arm_2R 3007311..3007424 506..620 92 -> Plus
arm_2R 3005978..3006480 1..505 97 -> Plus