Clone FMO10262 Report

Search the DGRC for FMO10262

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:62
Vector:pMK33-CFH-BD
Associated Gene/Transcriptsmi35A-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10262.5prime Sequence

1086 bp (876 high quality bases) assembled on 2010-11-11

> FMO10262.5prime
CAGTCGACATGTTGGATCGATGCGAAATGCCGATCCAGCTGGACAACGAG
AAGTTGCGGCGGGATGTTCGATTGTCGGGCTCTCGACTTGATTTGCCACA
ACTCTGTAATGGATCCCGTCGGTTGGATGGCCACAACAACCATGTGGCTG
CCAATGAGAACACGGTTACAACGACATCCCTGAATGGAAATGGCAACGGC
AATGGCAATAGCAATAGCAACAACAACAACAACATCGGATCGCCCGTCTC
CTCATCGACAACAAACAGCAGTAATGGCGGCAACGAGCGCGGCTCCTCCA
CAAAGTCCAATAGCAGCAGTGGAAGTGGCAGCTCGGGAAACTCGGCCAGC
AGCACGGGAAGTGGCGAGCTCAAATGCAATACGCCCATGACGCCATCTGA
GCTGGTGAAGAAGTTCCGCAACTACCTAACCGATCTTGAGTTCGAAGAGC
TCAAGGTGTACAAGGCAGTGTGGTATTTTGGCCAGCACGCCAGCAAGAAC
TACAACAAACCCGCCCCCACAGCCAATACCACAAATCTGGGCTATGACGA
TGATAATGGCAACTACAAGATCATCGAACACGATCACATAGCTTTTCGTT
ACGAGATTCTGGAGGTAATTGGCAAGGGCACCCCCCGGCCAGGTCATCAG
GGCGCTGGATCACAAGACCAACACACACGTGGCCATCAAGATCACTCCGG
AACAAGAAGCGCTTCCTCAACCAGGCCGTCGTCGAACTGAATATCCTCGA
TGAGCTGCGCGAAAAGGACGCGGATGGATCTCATAATGTCATACACATGC
TCGACTATACATATTTCCGCAAAGCATTTGTGTATTACTTTTGAGCTAAT
GAGCTTGAACCTGTACGAATTGATAAAGAAGAACAACTACAATGGATTCA
GCATGAGTCTCATACGACGCCTTCCCGCCACTTCGATTTGTTGAAGTGCC
TGCCGATTTGCTCTAATAAGGAAAAACATTTATTTCACTGTGATCTCAAG
CCCGGAAAAATTATTCTTTGCTTCAAACAGCGTGGCTAGCAGCTCCATTC
ACGGCTTACTCGAACCTCTCGCCAACCTCCATGCTA

FMO10262.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:00:26
Subject Length Description Subject Range Query Range Score Percent Strand
Dyrk2-RF 4663 CG4551-RF 835..1854 9..1049 4540 97 Plus
Dyrk2-RE 4590 CG4551-RE 762..1781 9..1049 4540 97 Plus
Dyrk2-RD 4417 CG4551-RD 589..1608 9..1049 4540 97 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:00:24
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 14196927..14197299 399..27 1850 99.7 Minus
2L 23513712 2L 14195733..14196010 853..573 1150 96.4 Minus
2L 23513712 2L 14196075..14196248 572..399 855 99.4 Minus
2L 23513712 2L 14189167..14189235 920..852 345 100 Minus
Blast to na_te.dros performed on 2014-11-26 17:00:25 has no hits.

FMO10262.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:06 Download gff for FMO10262.5prime
Subject Subject Range Query Range Percent Splice Strand
smi35A-RA 746..1783 1..1058 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:13:41 Download gff for FMO10262.5prime
Subject Subject Range Query Range Percent Splice Strand
smi35A-RD 578..1615 1..1058 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:43:49 Download gff for FMO10262.5prime
Subject Subject Range Query Range Percent Splice Strand
Dyrk2-RD 578..1615 1..1058 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:43:49 Download gff for FMO10262.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 14196927..14197293 33..399 100 <- Minus
2L 14196075..14196247 400..572 99 <- Minus
2L 14195733..14196010 573..853 96 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:13:41 Download gff for FMO10262.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 14196927..14197293 33..399 100 <- Minus
arm_2L 14196075..14196247 400..572 99 <- Minus
arm_2L 14195733..14196010 573..853 96 <- Minus