Clone FMO10263 Report

Search the DGRC for FMO10263

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:63
Vector:pMK33-CFH-BD
Associated Gene/TranscriptSAK-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10263.5prime Sequence

1039 bp (781 high quality bases) assembled on 2010-11-11

> FMO10263.5prime
CAGTCGACATGTTATCCAATCGGGCGTTTGGAGAAACAATTGAGGACTAT
GAAGTACAGCACTTGCTGGGTAAAGGTGGTTTTGCGACCGTCTACAAGGC
GCGGTGCCTGCACACTCACCAGGATGTGGCCATAAAGATGATCGATAAAA
AACTAATCCAGGGCACTGGACTCACTAACCGCGTTCGCCAGGAAGTGGAA
ATCCACTCCCGCCTGAAGCATCCCTCTGTGCTTCAGCTGTACACTTTCTT
TCAGGACGCCAACTATGTGTATTTGGTGCTCGAGCTGGCCCATAATGGGG
AGCTTCATCGCTATATGAACCACATCGCCAGACCCTTCACAGAGACGGAA
GCTGCTTCCATTCTGAAGCAGGTGGTGGCGGGACTTTTGTACCTGCACTC
CCACAACATCATGCACCGCGACATTTCGCTGTCCAACCTACTGCTTAGCA
GGGAAATGCACGTCAAGATAGCCGATTTTGGACTGGCCACCCAATTACAG
CGACCTGATGAGCGCCATATGACCATGTGTGGAACTCCGAACTATATTTC
GCCTGAGGTGGTATCGCGAACGTCTCACGGACTGCCCGCGGACGTCTGGA
GCGTTGGATGCATGCTGTACACCCTGCTGGTTGGACGCCCGCCCTTCGAA
ACCGATGCAGTGCAGTCAACCCTTAACCACCCTTGTGATGTCCGAGTACA
TTATGCCGGCTCACTTGTCTTACGAGGCGCAGGACCTGATAAACAAATTA
TTAAAAAAGCTCCCGCACGACGAATTACCCTGGAGCCTGTTCTCTGCCAT
CCCTTTATGTTGAAATGCTCAATGGTGGACACTCTGCGCCGGGAGCGTTG
AATGTGTTCAGCCAGAGTATGGAAAGTGGCGATAGTGGAATCATAACATT
TGCCAGCACTGACTCCCGGAATTCCCACCAAATTCGATCTGTGAAAACTC
AGACCACACAAGTGCTTCTCAAATACGGAGGATTTAGCAGTCCATCATAA
ACTGCCTTCTGAACAGAACAGGTTTATTTAGCCAGCCTC

FMO10263.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:00:28
Subject Length Description Subject Range Query Range Score Percent Strand
SAK-RA 3371 CG7186-RA 137..1165 9..1029 4705 97.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:00:27
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 21514739..21515508 908..140 3615 98.8 Minus
3L 28110227 3L 21515561..21515658 140..43 490 100 Minus
3L 28110227 3L 21515715..21515751 45..9 185 100 Minus
Blast to na_te.dros performed on 2014-11-26 17:00:28 has no hits.

FMO10263.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:06 Download gff for FMO10263.5prime
Subject Subject Range Query Range Percent Splice Strand
SAK-RA 134..1173 9..1039 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:13:44 Download gff for FMO10263.5prime
Subject Subject Range Query Range Percent Splice Strand
SAK-RA 137..1176 9..1039 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:43:51 Download gff for FMO10263.5prime
Subject Subject Range Query Range Percent Splice Strand
SAK-RA 137..1176 9..1039 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:43:51 Download gff for FMO10263.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 21515716..21515751 9..44 100   Minus
3L 21515561..21515656 45..140 100 <- Minus
3L 21514739..21515507 141..908 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:13:44 Download gff for FMO10263.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 21508816..21508851 9..44 100   Minus
arm_3L 21508661..21508756 45..140 100 <- Minus
arm_3L 21507839..21508607 141..908 98 <- Minus