Clone FMO10265 Report

Search the DGRC for FMO10265

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:65
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG32473-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10265.5prime Sequence

979 bp (678 high quality bases) assembled on 2010-11-11

> FMO10265.5prime
CAGTCGACATGGTTGCCTGGCTGACGGTTAAGTCAGTGGCCATCTTTTTG
GGCCTGGCCTCTACTGCTTTTTGTGTGGCCACGATTGTGCTGGCCGTTCA
GAATGCGGACCTGGAGAACGATCTGCAGGATGCCCTCGATAAGATCGACG
CATTGACGGTGGACACCACGTCCACGTCCTCCACCTCTACCAGCACTTCC
ACGACCACCACCACTGCAAATCCCAATGGGCCCACGGATGACACCGAGCC
TGGCTCTACCACCACACCTGGCGTAGGAGGTGACACAACCCCCAGTGCAG
GAACATCTCCGGGTGGTGAAACTTCGCCATCATCCAGTACAGGAAGCACC
ACCAATCCCATCTATCCGACATTGCCGACAGGACTTCCTGATCCTGAAAA
GATCGAATGGCGCCTGCCCACGGAACTGACGCCCATCAAGTACAAGGTGT
ACTACCATCCCAACTTGACGACCGGCGCCTGTGAGGGAACCGTGCCCCTT
CACCTCCACCTGAACGCGATCACCAACCTGATCGTCCTGCACGCCAAGGA
GCTCACTGTGCACAGCATCAGCATCCTGAACATGATGGCGCGCATACGCG
TGGCCATCGATAGCATCACCCCCCCCCCATTTCCGGGAGCTGCTCCTGAT
CACGCTAAGAGAGGTCCTCAGTATGACCCACCCCCCCCTACTGTCCTCAA
GTTTCCACTGCGATCTGAGCAGTCTGGTGGGCAGCTACATCAGCAACTAC
ACGAATGCCGATGGAGTAGATAGATCAATCATTTCCACACAGAATGTTTC
TCTTTTTATGCCCGCCAAGCATTCCCCTGCTTCGATGAGCCCGCCCTTAA
AGCTCAGTTCACCATAACGGTGGCCCGTCCAAGTGGTGATGAGTACCATG
TGCTGTCCACACGCCACTGACTAGCGAGTATGACGATGACCAACACCACC
GAGGTGACTTCGCGGGAGACGTACCCATG

FMO10265.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:00:31
Subject Length Description Subject Range Query Range Score Percent Strand
CG32473-RA 3273 CG32473-RA 78..1046 9..979 3995 94.6 Plus
CG32473-RB 3002 CG32473-RB 601..775 806..979 610 91.5 Plus
CG32473-RC 3635 CG32473-RC 1234..1408 806..979 610 91.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:00:29
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 13302798..13303180 19..401 1915 100 Plus
3R 32079331 3R 13304124..13304496 400..773 1415 92.5 Plus
3R 32079331 3R 13310176..13310309 806..938 530 94.8 Plus
Blast to na_te.dros performed on 2014-11-26 17:00:30 has no hits.

FMO10265.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:07 Download gff for FMO10265.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32473-RA 73..1041 9..979 94   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:13:46 Download gff for FMO10265.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32473-RA 78..1046 9..979 94   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:43:54 Download gff for FMO10265.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32473-RA 78..1046 9..979 94   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:43:54 Download gff for FMO10265.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 13304126..13304496 402..773 92 -> Plus
3R 13302798..13303180 19..401 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:13:46 Download gff for FMO10265.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 9129848..9130218 402..773 92 -> Plus
arm_3R 9128520..9128902 19..401 100 -> Plus