Clone FMO10270 Report

Search the DGRC for FMO10270

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:70
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG32372-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10270.5prime Sequence

1087 bp (860 high quality bases) assembled on 2010-11-11

> FMO10270.5prime
CAGTCGACATGACTTCCCTCGTGTACACCGTCTTTCACCTGGCCTCGCTG
CAATGTTCCGTGCGTCCGGAGATCTCGCCCTGCACCTGCGAAACGGGCAA
AGCCTGGAATCATGTGGAGCTCTCCTGCGAGAAGTTGGAATCCTTCAACG
CCGTCGTGGACAGCCTGGCCAATAAGCTCAATGCCGACACCAATATCGAC
CTAAAGATCACGCACTCGCAACTCGACGACCTGGAAATGCGCTCGTTTAC
GGATATGAACTTCAACTTGTACAAGCTACGGATGCAGTGGAACAGTCTAA
AATCGCTGCCCGAGGTGCCGTTCCGCGGGTTATCGAATGTCACCTACCTA
AGCATCGGCGACAACGACCTCGACGAGATCCCGAAGCACGCCCTGAGCCA
CATGCCGAGCCTTTTGACTCTGGACATTGGGCGGTGCAAGCTACGGGCGG
TGCAGCAGGAGGACTTCCGGGGCATACAGCGGGTAACGAATCTGATTCTG
GTGAGCAACATCATTACGCGCCTGGACCGAGGATCCTTTCCCAAGAGCCT
CCTCATCCTGCATCTGGGTAGAAACCAACTGGAGTCGCTGAATGGCTCGC
TTCACTATCTGCACAACTTGGAGTCTCTGTTCATCAATGCGAATAATATC
CCCTCCCTGGATGATGATCTACCCGATGGAGGGCAGTTGCGCCTCCTGAT
GGCTCACAATAATAGGTTGGAACGCCTGCCGGCCAATATGGCCGGTATGC
ACATTTTTGTATACTGTCCACATACACTGCAACCAGCTGAGATCCTTCGA
CCGTGTACTTCGCAATGCCGTCAATCTGTCCGAGGTCATGGCCCGATAAC
AATGAGCTGGAGTACCTGTTTCTATGTTTGTTATACTCCTCCTGCTCCAA
GGTGGAGACCCTGCAGATGGGCTGCATCACATCAGTCGCTCAACTCTTCG
CTACTGCCCATCCTCAAGCTGAAGACTGCCCAACTTCCTCGTTCAACGAC
ATCGTATTAGTTCTCCCATGGCGGACTGCACGGATTGGCGATCGCTGAGA
ACCTCCAGCCTGTCCAGTTATTCGCATTCCACGACTG

FMO10270.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:00:41
Subject Length Description Subject Range Query Range Score Percent Strand
ltl-RB 4108 CG32372-RB 689..1759 9..1087 4580 95.8 Plus
ltl-RA 3622 CG32372-RA 203..1273 9..1087 4580 95.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:00:39
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 7524487..7525184 302..1004 2770 95.2 Plus
3L 28110227 3L 7519685..7519977 9..301 1465 100 Plus
Blast to na_te.dros performed on 2014-11-26 17:00:40 has no hits.

FMO10270.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:09 Download gff for FMO10270.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32372-RA 198..1268 9..1087 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:13:54 Download gff for FMO10270.5prime
Subject Subject Range Query Range Percent Splice Strand
ltl-RA 203..1273 9..1087 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:02 Download gff for FMO10270.5prime
Subject Subject Range Query Range Percent Splice Strand
ltl-RA 203..1273 9..1087 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:02 Download gff for FMO10270.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 7524487..7525264 302..1087 94   Plus
3L 7519685..7519977 9..301 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:13:54 Download gff for FMO10270.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 7517587..7518364 302..1087 94   Plus
arm_3L 7512785..7513077 9..301 100 -> Plus