Clone FMO10272 Report

Search the DGRC for FMO10272

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:72
Vector:pMK33-CFH-BD
Associated Gene/Transcriptaz2-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10272.5prime Sequence

1078 bp (875 high quality bases) assembled on 2010-11-11

> FMO10272.5prime
CAGTCGACATGGTGGTTTGCGGGAACATTTTGGCCAGGAACAACTTCGAG
CACTTTGTTCTGGCGTGTGCTCACCAAAATGACTGCTACGTGGAGATGGA
GTTCAAGCGGTGGCGAGAGTTCATCGTGCACGTCAAGGAGCACCTGGAAG
CAAATCCAAGCATGCAGCAAGAGCTCACTACTTCCGAAGTCATTTCGTCA
GCCAAATGCGAGGAGGAGGTCTCGCCAGCCAAGGTGTTCATAGTGGAGGA
GCCTCCGGAAAATTGCCTGGCTGAAGACATGTTCGTTGACGTGCCACCTT
CATCAGAGAACGACGAGAGCACCAGCCCGGTGGAGGAGGAGGAGGAAGAA
GACGACGAGGTGGACTCCTCCTCGATGACAGTTGACTGCGAATTGGGCAC
CAGAAACTCCACACACTTTGCTCCTTTAACCAAATTCAATCCTACGTTTT
ACCGACGCAGTCCTCGGATCACACAGTTCATTGAACTGTATAAGCAGCAG
ACATGCCTCTGGGATCCAGCGGATGAGTCGTACAGGGACAAGGAGAAACG
CGCAAATGCCTATGAGGAGTTGCTGGAGCAATTAAAGGCGACCGTCAATC
TTCACCTCACCGTCTATAAGCTGAAGAAGTGCATCACCAGCCTACACGCG
CAGTATGCGTCCATCTCATTATTATATTATAACTCAGAAACTAACCAAGG
TTCCACTGTACTACCATGGAAAGTACAGCTTTCTGGCATAGCGCGGTAGT
CTGGAGGATGCGGACATTTATGATGTCTACGGCGATGGCAAAATAAAGCT
GGTGTTCACAGAGGAGAATCAACTGACCACACAGTTCATTGATTTGTACT
CCAAGTTTCCCCAACTGTACGATCCCGCGCAAAATTTTTTACTATCTTTC
TAAACGTACGAAAGTCATCGCTCATAGAGATCACTGACCTGCTGACTTCG
GAGTTTTCGTTGGGCTGGTCACCCACTACGATGTCTACGACAGTATCAGA
AGCATGCTCCTAATGGATTATTTCGCGACGGATCAAATCCTCCACAGAAC
GTTCCAATGGTGGTGGGTTCCCTCGCTT

FMO10272.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:00:47
Subject Length Description Subject Range Query Range Score Percent Strand
az2-RA 2006 CG1605-RA 54..1097 8..1059 4530 96 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:00:45
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 7512270..7512696 434..8 2135 100 Minus
2R 25286936 2R 7511841..7512203 798..435 1500 94.8 Minus
2R 25286936 2R 7511588..7511786 996..797 740 93.5 Minus
Blast to na_te.dros performed on 2014-11-26 17:00:46 has no hits.

FMO10272.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:11 Download gff for FMO10272.5prime
Subject Subject Range Query Range Percent Splice Strand
az2-RA 29..1072 8..1059 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:13:59 Download gff for FMO10272.5prime
Subject Subject Range Query Range Percent Splice Strand
az2-RA 54..1097 8..1059 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:05 Download gff for FMO10272.5prime
Subject Subject Range Query Range Percent Splice Strand
az2-RA 54..1097 8..1059 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:05 Download gff for FMO10272.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 7512270..7512696 8..434 100   Minus
2R 7511841..7512203 435..798 94 <- Minus
2R 7511531..7511784 799..1059 91 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:13:59 Download gff for FMO10272.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 3399775..3400201 8..434 100   Minus
arm_2R 3399346..3399708 435..798 94 <- Minus
arm_2R 3399036..3399289 799..1059 91 <- Minus