Clone FMO10275 Report

Search the DGRC for FMO10275

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:75
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCASK-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10275.5prime Sequence

980 bp (658 high quality bases) assembled on 2010-11-11

> FMO10275.5prime
CAGTCGACATGTGCCAGCATCATGGGCTGACATCACAGTCGTTGATGTCC
GGTGGCTCGCACATATCCCTGCTGGGCAGCAGCGGCAGCAGCGGTATGAG
CGGCAGCGGCGTCGGCAGCAGCGGTCAGAGTGTCCCGCAATGTCCCGCCG
CTGTGGCAGCCGCGGATGCCGCAATGATGGGCTCCAATGCCGGCGGCCAT
TGCCGCAGCCTGAGCGGCCTGAGCTCGATCAGCATACCGCCGCCGCCGCC
GGCGCTCTTCAATCCGTGCAGCTCGGCGCTGTCGCTGCAGCAGGCGGCGG
TAACCAGGTGGGGACCGCGCACCTCCTGCCCGGTCCACAGTCCGTTTCGT
GTGCGCGTGCCGAACGGCTCCATCTGCTCCGGACACCAGGCTCTGCTCCA
TAGCCACGATGTGGTGGCCCGGGATGTCTACGGGGAGGAGGCGCTCCGCG
TCACCCCGCCCCCGATGGTGCCCTACCTCAATGGCGACGAGCTGGACAAC
GTCGAGGGCGGCGAACTGCAGCATGTGACCCGGGTGCGACTGGTGCAGTT
TCAGAAGAACACGGACGAGCCCATGGGCATCACGCTGAAGATGACCGAGG
ACGGGCGGTGCATTGTGGCCAGGATTATGCACGGCGGGATGATTCATCGC
CAGGCCCCCCCCCCCACGTGGGCGACGAGATACACAAAGATCAACGGCCA
GCCGGTGCAGCATCAGTCGGTTGGACAATTGCAACGAATGCTGCGCGAGG
CACGCGGATCTGTCACACTCAAGATAGTTCCTACCTACCGCAACGCTCCG
CCCCCCTGCGAGCTTTTCAGGATCAGACCCGCTCCGGTGCTTATATTCGT
GCGCGCCCAATTCGATTATAATCCCCCTGCATCGATGAGCTTATACTCTT
GCAGCCCAGGCGGGCATATCGTTCCAGTGGGCGATATACTGCAGATTATT
AGCAGGACGATATCACTGGTGGCAGGCGCG

FMO10275.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:00:53
Subject Length Description Subject Range Query Range Score Percent Strand
CASK-RG 4071 CG6703-RG 1320..2288 8..980 4340 96.9 Plus
CASK-RD 4017 CG6703-RD 1320..2288 8..980 4340 96.9 Plus
CASK-RA 4112 CG6703-RA 1415..2383 8..980 4340 96.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:00:51
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 21803683..21804065 390..8 1915 100 Minus
3R 32079331 3R 21791960..21792149 576..387 935 99.5 Minus
3R 32079331 3R 21791729..21791894 743..575 595 92.9 Minus
3R 32079331 3R 21791531..21791604 812..739 250 89.2 Minus
Blast to na_te.dros performed on 2014-11-26 17:00:52 has no hits.

FMO10275.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:12 Download gff for FMO10275.5prime
Subject Subject Range Query Range Percent Splice Strand
Caki-RD 1312..2286 1..980 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:14:03 Download gff for FMO10275.5prime
Subject Subject Range Query Range Percent Splice Strand
CASK-RA 1409..2383 1..980 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:09 Download gff for FMO10275.5prime
Subject Subject Range Query Range Percent Splice Strand
CASK-RA 1409..2383 1..980 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:09 Download gff for FMO10275.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 21803684..21804071 1..389 99   Minus
3R 21791961..21792146 390..575 99 <- Minus
3R 21791729..21791893 576..743 92 <- Minus
3R 21791531..21791599 744..812 90 <- Minus
3R 21790709..21790738 813..842 100 <- Minus
3R 21789662..21789760 843..944 92 <- Minus
3R 21789550..21789587 945..980 94 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:14:03 Download gff for FMO10275.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 17629406..17629793 1..389 99   Minus
arm_3R 17617683..17617868 390..575 99 <- Minus
arm_3R 17617451..17617615 576..743 92 <- Minus
arm_3R 17617253..17617321 744..812 90 <- Minus
arm_3R 17616431..17616460 813..842 100 <- Minus
arm_3R 17615384..17615482 843..944 92 <- Minus
arm_3R 17615272..17615309 945..980 94 <- Minus