Clone FMO10276 Report

Search the DGRC for FMO10276

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:76
Vector:pMK33-CFH-BD
Associated Gene/Transcriptfu2-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10276.5prime Sequence

1072 bp (688 high quality bases) assembled on 2010-11-11

> FMO10276.5prime
CAGTCGACATGCATACATCGGATATCAGCATGACCCAGGATCAGGATGTG
AGCACTTGTCGCCTGTGCCACCATAATACGGATCCCAACTCGCTAAACAT
TTTCGATGACACCGTGCAGTTTTGCAAGGATGTGTCCATTGCAGAGGTTT
CCAAGAGTCTCTGGAGCGTTCAGTACGATCGCAACGAATGTTTGTCGGAG
CTCATTTGCTCAAGGTGTCTGGAGATCCTCGAAGAGGCATTCGAGCTGCG
AAAAGGAATGCAGGAGCGGGAACAGTCCCTGCAGGAGCAGCTGAAGGAGA
TGATTAAAGATCATCCGAAGCACCGTCCAGGCCTGAATGGCAACCCCGGA
GTATTCGTACCCGAGGAGGGCTGCATTATTGTGGAAGTTGATCCAGAGAA
TCTGGCAGAGAGCAGTGAAGAGGAATTCGCACTCGGCTCCGATGGGGAGT
ACGAAAACTATGACGACGATGATGAGGAGGAGGAGGAAGACTACGATGAG
GCGGACCAGGAAGATGGCCAGAACGGCGAAGACGTCGACATGCCACTGGG
CATGCATGCAGCCCAGATGGCGGCTCAACAGTCCGTTGCCAACAACGCCA
ACACCACGGAGGCACGGCCAAAGCCACCCCTCCTCTGTCAATACTGTGAT
CTTGGGTTCACTCTGCCCGCCGAGTGTCAAGAGCACCCCCCCCGCTGCAC
ACGATCCCAACGCACCGTACTGCTGCAACTTTTGCAACATCAAGCTGGTT
ACCCGGCCTGCTTTGATTTCGCACATAAAGACACTGCATGATCCCGCCCC
GTCCGTATGTGTGTGCTCACTGTCGGAAGGGTTTTGTGCGCCGCTCCGAT
CTTAAAAAGCACACAATCGTGCACACTGGCGTGAGGCCCTTTCACATGCA
ACGTTTGCTCCAAGAGTTTCTCGCCGCAATACAAATCTGACCAAGCAACA
TGCGCATTCATAGCGGTGTCAAGCCCTTTGTTTGCCAGCAGTGTCCGCGA
TCCTCAGAACGCCTGGTGGAAATGATGCGCCAACCACCGTTCGCACCGAG
ACAGCTTACAGCGCCATTCCAA

FMO10276.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:00:55
Subject Length Description Subject Range Query Range Score Percent Strand
fu2-RB 2149 CG9233-RB 123..1159 9..1051 4670 97 Plus
fu2-RA 1984 CG9233-RA 123..1159 9..1051 4670 97 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:00:54
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 8464830..8465658 171..1004 3665 97.4 Plus
2L 23513712 2L 8464610..8464774 9..173 825 100 Plus
Blast to na_te.dros performed on 2014-11-26 17:00:55 has no hits.

FMO10276.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:12 Download gff for FMO10276.5prime
Subject Subject Range Query Range Percent Splice Strand
fu2-RA 119..1157 6..1051 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:14:05 Download gff for FMO10276.5prime
Subject Subject Range Query Range Percent Splice Strand
fu2-RA 121..1159 6..1051 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:12 Download gff for FMO10276.5prime
Subject Subject Range Query Range Percent Splice Strand
fu2-RA 121..1159 6..1051 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:12 Download gff for FMO10276.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 8464833..8465704 174..1051 96   Plus
2L 8464608..8464774 6..173 99 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:14:05 Download gff for FMO10276.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 8464833..8465704 174..1051 96   Plus
arm_2L 8464608..8464774 6..173 99 -> Plus