Clone FMO10279 Report

Search the DGRC for FMO10279

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:79
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG11155-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10279.5prime Sequence

984 bp (659 high quality bases) assembled on 2010-11-11

> FMO10279.5prime
CAGTCGACATGGTACGAAAAAAACGAGAAATCGTAATAAAGGAAAATATT
CAAGGACGAAGTTACCTTAAAAAAATATGTTGTTCGTATATAATACTGTC
CATCCTCGTAATTTCTAATGCCTTGCCCCCAGTAATACGAGTAGGTGCCA
TATTTACGGAAGATGAACGCGAAAGCAGTATTGAATCTGCATTTAAATAC
GCAATATACCGTATAAATAAGGAAAAGACTCTTCTTCCCAATACACAATT
GGTTTACGATATTGAGTATGTTCCCCGAGATGACTCGTTTCGCACTACTA
AAAAGGTTTGCAGTCAGTTGGAAGCAGGTGTTCAAGCAATTTTTGGCCCA
ACAGATGCTCTTTTAGCTAGTCATGTACAATCCATATGCGAAGCATATGA
TATACCCCATATTGAAGGTCGAATTGACCTCGAATATAATTCTAAAGAAT
CCCCTATAAATTTATATCCGTCGCATACGCTCTTAACTCTACCATATACA
GATATAATGGTATATTTGAACTGGACGAAGGTGGCAATAATCCATGACCA
AGATTATGGTCTATTTAATTTGATGCACTCATCAACTGAGACGAAAGCGG
AAACGCATACCATGTAAGCAAGTCCGGATTCCTATCGCCAAGTTTTACGA
GCGATACGCCCCCCCCAACCTTACAAAATAATAGTGGATACCAATCCGTC
CCATATAAATCGTTTTTTAGATCCATTTTGCAACTACAAATGAATGACCA
TCGTTACCAGTACCTCTCCACAATATTCTACTTGGAGACATATGATCTGG
AAGATTTCAGATATAACAGCGTAAATATAACTGCATTTCGGCTGGTAGAT
GTCGATAGCAAAGATATCTCGAAGTAACTCCACCACATACAGAAATAAAA
CACCATCGCATTGGACACTATAAATGGAAAGTCCTTATATACAGACGGAG
TCCGCATTAATGTTTGATTCGTGTACGCGTTTGC

FMO10279.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:01:03
Subject Length Description Subject Range Query Range Score Percent Strand
CG11155-RD 4984 CG11155-RD 149..1125 9..984 4110 95.1 Plus
CG11155-RB 3644 CG11155-RB 149..1125 9..984 4110 95.1 Plus
CG11155-RA 2979 CG11155-RA 149..1125 9..984 4110 95.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:01:01
Subject Length Description Subject Range Query Range Score Percent Strand
4 1348131 4 1127000..1127417 143..560 1955 97.8 Plus
4 1348131 4 1126808..1126943 11..146 680 100 Plus
4 1348131 4 1128488..1128655 558..724 550 89.9 Plus
4 1348131 4 1129567..1129730 780..944 485 90.4 Plus
Blast to na_te.dros performed on 2014-11-26 17:01:02 has no hits.

FMO10279.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:13 Download gff for FMO10279.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11155-RC 144..1120 9..984 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:14:09 Download gff for FMO10279.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11155-RA 149..1125 9..984 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:16 Download gff for FMO10279.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11155-RA 149..1125 9..984 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:16 Download gff for FMO10279.5prime
Subject Subject Range Query Range Percent Splice Strand
4 1130025..1130065 945..984 97   Plus
4 1129566..1129730 779..944 91 -> Plus
4 1129435..1129488 725..778 87 -> Plus
4 1128489..1128655 559..724 89 -> Plus
4 1127002..1127415 145..558 97 -> Plus
4 1126802..1126941 4..144 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:14:09 Download gff for FMO10279.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_4 1150651..1150691 945..984 97   Plus
arm_4 1150192..1150356 779..944 91 -> Plus
arm_4 1150061..1150114 725..778 87 -> Plus
arm_4 1149115..1149281 559..724 89 -> Plus
arm_4 1147628..1148041 145..558 97 -> Plus
arm_4 1147428..1147567 4..144 97 -> Plus