Clone FMO10280 Report

Search the DGRC for FMO10280

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:80
Vector:pMK33-CFH-BD
Associated Gene/Transcriptort-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10280.5prime Sequence

900 bp (658 high quality bases) assembled on 2010-11-11

> FMO10280.5prime
CAGTCGACATGGTGTTCCAAATAATAATCCTGGTGATCTGCACCATCTGC
ATGAAGCACTACGCCAAAGGGGAGTTTCAACAAAGTCTGGCCATAACCGA
CATCCTGCCCGAGGACATCAAGCGTTACGACAAGATGAGACCGCCGAAGA
AAGAGGGTCAGCCGACGATAGTCTACTTCCATGTGACGGTGATGGGTCTG
GACTCCATTGATGAAAACTCGATGACTTATGTGGCGGATGTGTTCTTTGC
ACAGACGTGGAAGGATCATCGCCTGCGATTGCCGGAGAATATGACACAGG
AATACCGCCTGCTCGAGGTGGACTGGCTAAAAAATATGTGGCGGCCGGAT
TCGTTTTTCAAAAACGCCAAATCGGTGACCTTTCAGACCATGACAATACC
CAATCACTATATGTGGCTGTACAAGGATAAGACCATTCTGTACATGGTCA
AAATAACACTGAAGCTGTCCTGCATCATGAACTTCCCCATTTATCCTCAT
GATACACAGGAGTGCAAGCTGCAAATGGAAAGCCTGTCCCACACCACGGA
TGACTTGATATTCCAGTGGGATCCAACAACGCCCCTTGTGGTTGATGAAA
ACATCCCACCTGCACTATTGTGGCCCTCATCCGAAATGAAACGGCGGACT
GTACCCAAGTTTATCCCCCCCCCCAACTTCACATGTCTGGACGTGGTGTT
CACCCTTAAGCGTCGTTTGGTTTACTACGTTTTCAACACCTACATTCCCA
CCTGCATGATAGTGATCACGCCCCGAGTATCCTTCTGGATCACACCGCGC
GCGCGCCACCAGCCCGTGTGACTCTGGGTGTCACCTCCTTGCTAACGCTT
TCCACGCAACACGCCAAATCGCAGTCGTCTCCGCCACCCCGCTCAATATA

FMO10280.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:01:07
Subject Length Description Subject Range Query Range Score Percent Strand
ort-RA 2158 CG7411-RA 349..1223 9..888 3885 96.5 Plus
HisCl1-RD 1693 CG14723-RD 548..811 159..422 270 74 Plus
HisCl1-RC 1707 CG14723-RC 430..693 159..422 270 74 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:01:05
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 19661721..19662175 80..534 2230 99.3 Plus
3R 32079331 3R 19662286..19662634 535..888 1185 91 Plus
3R 32079331 3R 19661592..19661662 9..79 355 100 Plus
3R 32079331 3R 11788021..11788219 224..422 185 72.9 Plus
Blast to na_te.dros performed on 2014-11-26 17:01:06 has no hits.

FMO10280.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:14 Download gff for FMO10280.5prime
Subject Subject Range Query Range Percent Splice Strand
ort-RA 342..1223 1..888 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:14:10 Download gff for FMO10280.5prime
Subject Subject Range Query Range Percent Splice Strand
ort-RA 342..1223 1..888 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:17 Download gff for FMO10280.5prime
Subject Subject Range Query Range Percent Splice Strand
ort-RA 342..1223 1..888 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:17 Download gff for FMO10280.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 19662286..19662634 535..888 92   Plus
3R 19661721..19662175 80..534 99 -> Plus
3R 19661585..19661662 1..79 94 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:14:10 Download gff for FMO10280.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 15488008..15488356 535..888 92   Plus
arm_3R 15487443..15487897 80..534 99 -> Plus
arm_3R 15487307..15487384 1..79 94 -> Plus