Clone FMO10281 Report

Search the DGRC for FMO10281

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:81
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG31033-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10281.5prime Sequence

998 bp (689 high quality bases) assembled on 2010-11-11

> FMO10281.5prime
CAGTCGACATGTCTACGGAGGAGCATGTGTGGCGAGCGCACGTCGTGCGG
CGCTTACGCGAGCGAAATCGCAAGGAGTGCGACAACTTCAAGGAGATCAT
CGAGCAAAACAACCGACTGATTGACCATGTGGCGCAACTGAAGGCGGACA
ACCTGAAGATCTCCGTCGAAAACGAGCAGCTCCGCAACGCGGTGTCAACA
GGTGGCACCGGCTCCAACGTGGCTATCGCCACCCTCGAAAAGAAGCTGCT
CAGCCAGCAGGAGGAGCTCACAGAGCTACACAAGCGCAAGGGCGAGAACT
CCCAGATGATCGTGGACCTCAACCAGAAGGTCGAGCAGCAGAGGATCATA
ATTTCCGAGAAGGAGCACAGCCTCGTCATTTTTTTAAACGAACAACAACC
GATTGCGCGCGGAGGTGCAGCTACTTCACTCGAGTTTGGAGGAACTCAAG
AAGCTGAACAACCAACTGCTGGACGAACATACGGCGCTTCAATTGGCATT
TAGCTCCCTCGAGGAGAAGTTAAGGGGAGTGCAAGATGAAAATCGGCGTC
TACTGGAGCGACTTATGCAATACAAGTCAAAGGATGCCGACAAGTTGAAC
GAGGAAAACGAGAGCATAATTACGAAACGTTCGGCTAAACTGAAACGTGA
CCTAGAAGACGCGGTTCGTGAGCCCAGTTCCCCCCCCTATCTTTTTTTTC
TTCGCCCGGCGCCGCATCCTTGCAGCGCAACTCCAGTCTCGCTCAGTTTC
GTTGGCGGTCTCATCGGCGACGAGGATTTCGACGACCGCTGCCTATTAAT
TGGTTTTCATGGTAGGCCATAGGTCTCGATGATAATGAATATATTAGCGC
TCGTTTTACAGCAGCGAAATCGCCGAGAACTCGCGGGCTTCCATCGACAC
CTGAAGGCCACGCGCCACCTTGTGTCTATGTCTATTCCCACCAGATCCTC
ATGAAGTTCGAGTCCCACGAGAACGAGTCGCACGCGTGCGCTGGAGTC

FMO10281.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:01:11
Subject Length Description Subject Range Query Range Score Percent Strand
Atg16-RC 2350 CG31033-RC 255..1238 7..998 3965 94.4 Plus
Atg16-RF 2374 CG31033-RF 255..1262 7..998 3720 92.3 Plus
Atg16-RB 1668 CG31033-RB 100..556 535..998 1500 90.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:01:08
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 29834361..29834622 370..109 1310 100 Minus
3R 32079331 3R 29831981..29832348 998..624 795 86.2 Minus
3R 32079331 3R 29833932..29834081 535..386 705 98 Minus
3R 32079331 3R 29834746..29834847 108..7 510 100 Minus
3R 32079331 3R 29833194..29833281 622..535 440 100 Minus
Blast to na_te.dros performed on 2014-11-26 17:01:09 has no hits.

FMO10281.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:15 Download gff for FMO10281.5prime
Subject Subject Range Query Range Percent Splice Strand
CG31033-RD 255..1238 7..998 94   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:14:13 Download gff for FMO10281.5prime
Subject Subject Range Query Range Percent Splice Strand
Atg16-RC 255..1238 7..998 94   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:19 Download gff for FMO10281.5prime
Subject Subject Range Query Range Percent Splice Strand
Atg16-RC 255..1238 7..998 94   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:19 Download gff for FMO10281.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 29834746..29834847 7..108 100   Minus
3R 29834361..29834622 109..370 100 <- Minus
3R 29833933..29834095 371..534 93 <- Minus
3R 29833193..29833281 535..623 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:14:13 Download gff for FMO10281.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 25660468..25660569 7..108 100   Minus
arm_3R 25660083..25660344 109..370 100 <- Minus
arm_3R 25659655..25659817 371..534 93 <- Minus
arm_3R 25658915..25659003 535..623 98 <- Minus