Clone FMO10282 Report

Search the DGRC for FMO10282

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:82
Vector:pMK33-CFH-BD
Associated Gene/TranscriptBtk29A-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10282.5prime Sequence

1024 bp (665 high quality bases) assembled on 2010-11-11

> FMO10282.5prime
CAGTCGACATGATTCCCTGCGTGAGTTTGGCCGAAACGAGCGTCATTGGC
AACATGAAGGAGCGGGTCAAGGAAATGAAGGTGTTCGGCTGCCGACTCAA
CTTCTGGAACCACATTGGTCACAGCCTGACCAGTTCCAAAACCAAAGAAG
GCAACGGCAGTTCTCCAGCCCAGAATTCAACGCGCAGCATCAGTCCCAAC
AGCTCCACGACCAACAGTCAGTTTAGCTTGCAGCACAACAGCTCGGGGAG
TCTCGGCGGAGGAGTGGGCGGCGGATTGGGAGGCGGAGGCAGCCTTGGCC
TAGGCGGCGGAGGAGGAGGTGGCGGCAGTTGCACGCCCACATCGCTACAG
CCTCAGTCCTCGCTGACAACTATTAAGCAGTCCCCAACTCTATTGAACGG
CAACGGAACTCTATTGGATGCCAATATGCCTGGCGGTATACCCACTCCCA
CCCCACCAAATTCCAAAGCCAAGGACAACTCCCACTTTGTCAAGCTGGTG
GTGGCTCTCTATCCATTCAAGGCCATCGAAGGCGGCGATTTATCGCTGGA
AAAGAATGCCGAATACGAAGTGATAGATGACTCACAAGAGCACTGGTGGA
AGGTCAACCATGTCTTGTGGAATGTCGGCTATATACCCAGCAACTATGTC
AAGCCGAACGCTCCCCCCGTTTTGTATTGCTATGAATGGTATGTGGGCGA
CATGTCACGACAGACAGCCGAATCGCTGCTGAAGCAAGGTGATAAGGAGG
GCTGCTTTGTGGCCGCCTATTCATCTATCTAAGGGTCTCTACACACTATC
GCTGCATACCAAAGTTCCACAGTCGCATGTGAAGCACTACCACATCAAGC
AAAATGCTCGCTGCGAGTATTATTTGAGTGCCACCAATTGATTGATAAAA
TAATTCCCGATCTGATTAACTACCATCGCACAACTCTGGGGGTTTGGCTT
GCCGACTCAAATCTCGCCCTGCGATCGCCCAGTTCACCGACGGCCGGGAA
CTTGTACCACGACAAATGGGTAGA

FMO10282.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:01:14
Subject Length Description Subject Range Query Range Score Percent Strand
Btk29A-RF 4992 CG8049-RF 2148..3156 9..1020 4245 95.1 Plus
Btk29A-RA 4026 CG8049-RA 432..1440 9..1020 4245 95.1 Plus
Btk29A-RC 3279 CG8049-RC 435..1443 9..1020 4245 95.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:01:12
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 8262475..8262682 356..149 1040 100 Minus
2L 23513712 2L 8271935..8272077 151..9 715 100 Minus
2L 23513712 2L 8261479..8261681 1020..816 535 89.4 Minus
2L 23513712 2L 8262284..8262404 474..354 515 95 Minus
2L 23513712 2L 8261965..8262075 663..553 480 95.5 Minus
2L 23513712 2L 8261740..8261868 815..686 465 92.3 Minus
2L 23513712 2L 8262139..8262221 554..472 415 100 Minus
Blast to na_te.dros performed 2014-11-26 17:01:13
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6812..6934 122..252 112 63.7 Plus

FMO10282.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:15 Download gff for FMO10282.5prime
Subject Subject Range Query Range Percent Splice Strand
Btk29A-RF 2211..3221 9..1023 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:14:15 Download gff for FMO10282.5prime
Subject Subject Range Query Range Percent Splice Strand
Btk29A-RC 435..1445 9..1023 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:20 Download gff for FMO10282.5prime
Subject Subject Range Query Range Percent Splice Strand
Btk29A-RC 435..1445 9..1023 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:20 Download gff for FMO10282.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 8271936..8272077 9..150 100   Minus
2L 8262475..8262680 151..356 100 <- Minus
2L 8262285..8262401 357..473 94 <- Minus
2L 8262139..8262219 474..554 100 <- Minus
2L 8261973..8262073 555..655 96 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:14:15 Download gff for FMO10282.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 8271936..8272077 9..150 100   Minus
arm_2L 8262475..8262680 151..356 100 <- Minus
arm_2L 8262285..8262401 357..473 94 <- Minus
arm_2L 8262139..8262219 474..554 100 <- Minus
arm_2L 8261973..8262073 555..655 96 <- Minus