Clone FMO10286 Report

Search the DGRC for FMO10286

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:86
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRs1-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10286.5prime Sequence

1081 bp (940 high quality bases) assembled on 2010-11-11

> FMO10286.5prime
CAGTCGACATGGGTGCAACCAAGAACCTGGACTTGATAGGCACCATCGAA
GACGATGCCGAGGTGGAGAACTTGTCGGAGGACTCCGATGCGGAGGTCGA
GTACCAACCCACAAAACTGAGACACAAGAAGGTGACGGAGTTTGAGAAGG
GCTTCGAGTTCGTGTCCTCAGTGAAGGAGTACAACCAGGACACTTGGGAC
GACCTGATGAAGTACGTGAAGCGAAAGGCGCGCACAAAGACCGACGACAA
GATCGCCGCCCGGCTGCAAAAGCGGGGTGGCGCCGAAGCTGTGGCCGCGG
AGCAGAGCGATGGAAGTGAGATAGATCTCTCCGAGGACGAATTGAAGCAT
GACAACCTGCGGCTAAGGGAGAAGAAGGAATCCAAAAAAAAGAAGAAGAA
GGCTGGAGAGGAGGATGAAGAGGACGAGGGCGAGAAGATGCAGTTCGCCG
ACACTGTAGAGGCGAACGAGCAGATCACTTCCTTCTACCAAATGAACCTT
TCACGTCCCCTGATGCGTGCCATCGGTGTGCTGGGGTACATATATCCTAC
GCCGATCCAGGCCTCTACGATTCCTGTGGCTTTGCTAGGTCGCGATATCT
GCGGCTGTGCTGCCACGGGAACGGGCAAATCTGCTGCTTATATGTTGCCT
ACTCTAGAACGTTTGCTGTATCGTCCTCTTAACAACAAGGCCATCACCAG
GGTACTGGTTCTTGTGCCCACTCGTGAGCTGGGCGCCCAGGTTTACCACG
TGACAAAGCAATTGTGCCAGTTCACCACTATTGATGTGGGTCTGGCAATT
GGTGGTCTGGATGTGAAGGCTCACGAGGCAGTACTTCGCCAGATCCCGAC
ATTGTCATTGCAACGCCAGGTCGTCTAATCGATCACATTAAAAATACGCC
CAGTTTTACATTGCATTCCATTCAAGGTTCTCATTCTGGACGAGGCCGAT
CGTATGCTGACGAGTACTTCGCCGAACAGATGAAGAGATCATCAACTCTG
CTGTAAGACCGTCAGACATGTTGTTCTCCGTCCACATGAGCGAGCAAGTC
AAGATCTGCTGCGTATCGCTGGACAAGCCAT

FMO10286.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:01:24
Subject Length Description Subject Range Query Range Score Percent Strand
Rs1-RB 2670 CG2173-RB 220..1298 9..1079 5000 98.2 Plus
Rs1-RA 2527 CG2173-RA 77..1155 9..1079 5000 98.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:01:22
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 8165105..8165928 100..922 4010 99.4 Plus
2R 25286936 2R 8164956..8165048 9..101 465 100 Plus
2R 25286936 2R 8166114..8166276 925..1079 345 90.8 Plus
Blast to na_te.dros performed on 2014-11-26 17:01:23 has no hits.

FMO10286.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:17 Download gff for FMO10286.5prime
Subject Subject Range Query Range Percent Splice Strand
Rs1-RA 72..1153 9..1081 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:14:22 Download gff for FMO10286.5prime
Subject Subject Range Query Range Percent Splice Strand
Rs1-RA 77..1158 9..1081 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:24 Download gff for FMO10286.5prime
Subject Subject Range Query Range Percent Splice Strand
Rs1-RA 77..1158 9..1081 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:24 Download gff for FMO10286.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 8166116..8166279 927..1081 92   Plus
2R 8165107..8165931 102..926 99 -> Plus
2R 8164956..8165048 9..101 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:14:22 Download gff for FMO10286.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 4053621..4053784 927..1081 92   Plus
arm_2R 4052612..4053436 102..926 99 -> Plus
arm_2R 4052461..4052553 9..101 100 -> Plus