Clone FMO10287 Report

Search the DGRC for FMO10287

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:87
Vector:pMK33-CFH-BD
Associated Gene/TranscriptAnk2-RE
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10287.5prime Sequence

1040 bp (684 high quality bases) assembled on 2010-11-11

> FMO10287.5prime
CAGTCGACATGGCCCAGTTTGTGACCCACATCCAGCCAACGCTGATGGAG
GCGTCCCAAGGTCATGTTCCTCACCACCACGGACATCAGGTGGGTGTGCA
GCACTCGTCGCATCTGCCCCACAGCGGCCACAACATGCCCTCGCCGCCAA
CCCACAATCACCATCATGCCCACGGACATGGTCATCATACCAGCAGCGGT
GGTCATCATGGAGGAGCAGGTGGCCATTCACAGAAGCAGGCAGCGCATCA
TAGCACCACCTCCGGCCACGCCGCCAAGGGACAGCACCACAGCCCACCGT
CGAGGATCCATTCACCGCCAACGGAACACCATCCGGATCATGTCGGTCAC
TACGAGTACTTCCAGCATCAGCACGAGCAGATCTTCCACCATGAAGGAGC
AAACGGTGGTGCCAGCCACAAGCAACAGACCCACCACCTTTCCAACAAGC
ACGAGCACTGCCCCACAGGACACCAGAGTGCGGGCGATGGAAACACTTCC
TTCCTGCCTGCCGCTCGCGCCGGAAATCTGGAGCGAGTGCTCGAGCATTT
GAAGAACAACAATGACATTAACACCAGCAATGCGAATGGCTTGAATGCCC
TGCACCTGGCCTCCAAGGATGGCCACCCCTCACGTCGTCTCGGAACTCCT
TCGTAGGGGCGCGATTGTGGATAGTGCCACCAAAAACCCCAACACTGCCC
TCCACATCGCCTCATTGGCTGGACAGGAGGAGGTGGTGAAGCTACTGCTG
GAGCACAATGCCTCCGTAAATGTGCATCCCAGAATGGATTCACTCTACTC
TACATGGCCACCCCAGCAGAACCACGATGCTGTGGTGCGTCTCCTTTTGT
CCAACGGAGCCAACCAGAGTCTGGCCACCGAGGATGGCTTCACCCCACTG
GCCGTCGCCCATGCCACTCAGCATCTTGACTTAGTCGTTGCACGTCCCTC
CCTCGAGAGTGATACTCGTGCAAAGGTCAGGCTTCCCTGGCGCTGCACAT
TGCCGCCAAAAGGACGACGTCAAGGCAGCCAACTCTGCCT

FMO10287.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:01:27
Subject Length Description Subject Range Query Range Score Percent Strand
Ank2-RE 2780 CG42734-RE 556..1576 9..1038 4460 96.3 Plus
Ank2-RK 14309 CG42734-RK 556..1576 9..1038 4460 96.3 Plus
Ank2-RR 15005 CG42734-RR 556..1576 9..1038 4460 96.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:01:25
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 7717366..7717840 483..9 2345 99.6 Minus
3L 28110227 3L 7710365..7710802 1029..584 1405 91.7 Minus
3L 28110227 3L 7710868..7710970 584..482 485 98.1 Minus
Blast to na_te.dros performed on 2014-11-26 17:01:26 has no hits.

FMO10287.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:18 Download gff for FMO10287.5prime
Subject Subject Range Query Range Percent Splice Strand
Ank2-RK 493..1521 1..1040 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:14:24 Download gff for FMO10287.5prime
Subject Subject Range Query Range Percent Splice Strand
Ank2-RR 549..1577 1..1040 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:26 Download gff for FMO10287.5prime
Subject Subject Range Query Range Percent Splice Strand
Ank2-RR 549..1577 1..1040 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:26 Download gff for FMO10287.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 7717367..7717847 1..482 98   Minus
3L 7710868..7710969 483..584 98 <- Minus
3L 7710355..7710801 585..1040 92 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:14:24 Download gff for FMO10287.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 7710467..7710947 1..482 98   Minus
arm_3L 7703968..7704069 483..584 98 <- Minus
arm_3L 7703455..7703901 585..1040 92 <- Minus