Clone FMO10288 Report

Search the DGRC for FMO10288

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:88
Vector:pMK33-CFH-BD
Associated Gene/TranscriptMio-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10288.5prime Sequence

1079 bp (761 high quality bases) assembled on 2010-11-11

> FMO10288.5prime
CAGTCGACATGATGCTGAATAAACACGAGGGATACCAACGCACAAGCCAA
ATGTTTCCCCACCAGCAGCACCAGCTGCCTCAGCTGCACCAGCAGCCTTA
TCTGCAACAGTCTCTGTGCCAAAACTTCCAGCAATTGCAGTACGAAACGG
GAGTAGGTGCTTCGGCGTCAGGGTCCGCCGAGGCTACGGCAGACCTGCTC
AAGGCGGAGCGGGAGTCTATCCACTCCGGCCAGTTTATGGTCTCGCACTT
CGAGGCAGAGGAGGCGCAGGACGACCTAGAGGATGACGGCGAGGTGAAGA
TGCTAGACCCTGAGGACCCCGGTCTGGGCAAGCCGGGCGAGCCAACCAAC
ACATGTCGTGACGTGCAGCTTTACGTACCCCAAACAGTGGCCCACTTCAG
CGCCATGGACCAGGAGGGCGACGAGAGCAGCATGAGCATGGTGACCTCCC
ACCTGGAGATAGAGACCTCGCTCACCAAACTCTTCAAGTGCATGAATCTG
GCCTACAGTCAAAAACTAACCTCACCCAAATGGAATCATTTCAAAGGAGT
ACGACTTCGGTGGAAGGACAAAATTCGCCTGAACAATGTCATCTGGCGTT
GCTGGCACATGCAGTTCATACAAAAGCGCAGAACCCCGGTGTGTCAATTT
GCGTCGCCCCTGCCCGTTGATATACATAGTAATCCTCAAACTGTTGTTCT
TGAAGGCCAATACTCCCAACCCGCACTCAGCTGTTATAAAAGCCGAATAC
AGGAAATGGCGCAGCATCTATATGTCGAACGCTACGGGCTGCTTAACATA
TGATTCGAAAAGCGAATTAGACTTTTTGGAATGGTCGCCTCTGAACGATA
GGAACTTAATGCCAGACGATCGCCACCACCTACACCTTATTCTCGGCTAT
CAACGTTCCATTCCCATTTCCAGATTCTAGGGAAATCGCACGCGGCGCGG
GCATCGCGGACTTTATACAGCCCAGTCCTTGCTCCCCTTGCCACCCGAAG
TTAGAATGACATCGACATTAGCTTTCGACTGCACTCCACCCACCCGCTTG
CCCTCAGTTCCGGAGAGGACGACGCTGAA

FMO10288.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:01:30
Subject Length Description Subject Range Query Range Score Percent Strand
Mio-RM 4068 CG18362-RM 495..1565 9..1079 4675 96.3 Plus
Mio-RL 3832 CG18362-RL 259..1329 9..1079 4675 96.3 Plus
Mio-RK 3830 CG18362-RK 257..1327 9..1079 4675 96.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:01:28
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 21308288..21308787 508..9 2500 100 Minus
2L 23513712 2L 21304825..21304936 615..504 560 100 Minus
2L 23513712 2L 21289615..21289745 938..807 535 95.5 Minus
2L 23513712 2L 21297695..21297811 807..690 405 91.5 Minus
2L 23513712 2L 21301454..21301527 689..616 325 95.9 Minus
2L 23513712 2L 21289510..21289549 977..938 200 100 Minus
Blast to na_te.dros performed 2014-11-26 17:01:29
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2386 60..139 112 60 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2495..2536 56..97 111 73.8 Plus

FMO10288.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:18 Download gff for FMO10288.5prime
Subject Subject Range Query Range Percent Splice Strand
Mio-RC 191..1217 1..1030 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:14:26 Download gff for FMO10288.5prime
Subject Subject Range Query Range Percent Splice Strand
Mio-RK 248..1274 1..1030 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:29 Download gff for FMO10288.5prime
Subject Subject Range Query Range Percent Splice Strand
Mio-RK 248..1274 1..1030 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:29 Download gff for FMO10288.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 21308288..21308796 1..508 99   Minus
2L 21304825..21304931 509..615 100 <- Minus
2L 21301454..21301527 616..689 95 <- Minus
2L 21297695..21297811 690..807 91 <- Minus
2L 21289615..21289744 808..938 95 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:14:26 Download gff for FMO10288.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 21308288..21308796 1..508 99   Minus
arm_2L 21304825..21304931 509..615 100 <- Minus
arm_2L 21301454..21301527 616..689 95 <- Minus
arm_2L 21297695..21297811 690..807 91 <- Minus
arm_2L 21289615..21289744 808..938 95 <- Minus