Clone FMO10290 Report

Search the DGRC for FMO10290

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:90
Vector:pMK33-CFH-BD
Associated Gene/Transcriptdream-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10290.5prime Sequence

902 bp (616 high quality bases) assembled on 2010-11-11

> FMO10290.5prime
CAGTCGACATGGGTTGGTGGAGCAAGAAAAGCGAGACGGATCGCAGTCAG
CCCAGCCAGGAACTGGTGGCGCAGGACCCGCGCACACGAGTCCAGACTAC
GAGTGCAGCCACGGAGACGACCAACACAGCCGTGCAAAACTCGACCATAA
CGGACAACAACAAGCAGACGGTTACCTTTCTCACCACCCGCCAGACGGTG
ACGCACACGCAGCGGGCGCTGATCACGGAGACGACAACGCGACGCACGCC
TAGTCAGGCGGAGTTAGAGGCTCTCTTCGCAAAGATAAAGATGGGCGGTG
AGGGACCCATTGGCTCCACCACCACCACTACGACGACCACCTCCTCGCGC
TCCCGACCGCCCAGTTTGAACGGCGTCTCCTTTCGCTCCACACAACCCTT
CAAAGCCACGGCAAGCAATGCTGGCAAACGGTCAAGCACCTTAGTCAAGA
CCGAGCAGCACACAGTGACCCAAAAGAATGGGCGCACGGTCACCCAGCCC
CTGGAGACTCATAGAGTGGACCTCAAGGGAAGTCGACCTAAGGCGACCTG
GGCGTCATTTGCGTCCACTGCAAACAGCTCAACATCCAGCTACGTCTCAC
CTTATCGTCAGAAGCCAACCCCCCCCTCTTTCTTGCACATCTCCCAACAT
CAAGACACCAAAAACCACTAGCTCCACCCCCCCCCCCCAGTGCCAGCTCC
ATTACCACTCCGCCCAAACCATCATCATCTGTATCCTCCATTTCAAGCAT
TTTCATTTCTGCTTTCAAGCAGTTGACTAGCCGCCCCGACTTTTCTGTAT
ACTTTCAATGACTTCATTAGTCTGGGATCGTCAGAGGCACCAAGCCGAAG
TCACTGCCGTCGCGCAATCCCAAGATGCCCAGGGCACGATTTCACGACGC
CT

FMO10290.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:01:36
Subject Length Description Subject Range Query Range Score Percent Strand
Strica-RB 2720 CG7863-RB 103..987 9..894 3700 95.1 Plus
Strica-RA 2163 CG7863-RA 103..987 9..894 3700 95.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:01:34
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 6022158..6023042 894..9 3530 94.7 Minus
Blast to na_te.dros performed on 2014-11-26 17:01:35 has no hits.

FMO10290.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:19 Download gff for FMO10290.5prime
Subject Subject Range Query Range Percent Splice Strand
dream-RA 965..1057 812..902 95   Plus
dream-RA 157..909 1..755 96 == Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:14:31 Download gff for FMO10290.5prime
Subject Subject Range Query Range Percent Splice Strand
dream-RA 903..995 812..902 95   Plus
dream-RA 95..847 1..755 96 == Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:31 Download gff for FMO10290.5prime
Subject Subject Range Query Range Percent Splice Strand
Strica-RA 903..995 812..902 95   Plus
Strica-RA 95..847 1..755 96 == Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:31 Download gff for FMO10290.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 6022298..6023049 1..755 96   Minus
2R 6022150..6022242 812..902 95 == Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:14:31 Download gff for FMO10290.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 1909803..1910554 1..755 96   Minus
arm_2R 1909655..1909747 812..902 95 == Minus