Clone FMO10292 Report

Search the DGRC for FMO10292

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:92
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG6201-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10292.5prime Sequence

1000 bp (663 high quality bases) assembled on 2010-11-11

> FMO10292.5prime
CAGTCGACATGCTGTCGCTACTCCTGGTTCTGACGACGCTTGCCAGGATC
CACGCCCACTACACGAGCGGAGATGTGGTCTATCACACAATGCCGCACTT
TTGGACGGGCGTGGGCTTCTGTCCCGCCGGACGCATTGATCACGAGGGGA
TTAGCGCCGCCCTGGGCGATCCAGCCCTTCGACTTAATCTTCGCCTGATT
GCAGCATTGCCCGTGGGCGCGGTGACCCACATTCGCATCCACTGGCTGCT
GGAGCTGATACAATTCTGGCAGTACGACCCCAGCGGAATACCGATTTATG
ATTTTTCCAAGTTCGATGACTTCATTGATTTCCTACACGAGGAACTGCGC
TTGTCCCCCGTTCTGGAGTGGATGGGCAATCTGGGTGGGGTTTTTTCGGA
AAACCCCATGCAGCAATCCTTCTACTGGGAGCACTTGGTTAAGACCACCC
ATAACCACCAGATAGCACGACACGGTTCCTCCAGATTGGTCAACTGGCGC
TATGAGACATGGAATGAACCGGACCTTCGTGGGTATAACAAGCAAAACTT
TACGGCACACACCTTTCTGGATTACGTTCAAGCTGTGCGGCGGGGTTTGA
GTCCAACCCGGATACCTGAACAACCAGGACGGAAAGGTTCCACTGCCCAT
GTATCGCTCCCCCCCCCCTCCTGTATGATTCTTTAAGGACTCGAATCATC
CGCTCTGCTGGAATCTATTGGAGCTATGCAGTCAAAGAGTGGTTTACTGT
CCATCGACGTACCGACTTTTTATTTAATAGGGAATCCAACGCACTGCCAC
GGAAATCGTAAATGGTTCGCTTTCCTTGATGGCCAAATCTATGAGAGTAT
CCCATCTCAAGCAGCTGCCCGCGCGCCCACTCCTTGATAGTCTTTTTCAT
GATAGTCCCCCTGGAGCACCTCCCGGGATTTTCAGGCGGATGTGCGGTAT
GGAATCACACTGATATCTACGGTAATGCAGTTCTGGCATGCCAAGCTGCC

FMO10292.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:01:41
Subject Length Description Subject Range Query Range Score Percent Strand
CG6201-RA 2308 CG6201-RA 113..1096 9..998 4045 94.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:01:40
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 11112493..11112949 465..9 2240 99.3 Minus
2L 23513712 2L 11112026..11112433 869..464 1405 92.9 Minus
2L 23513712 2L 11111827..11111913 998..912 435 100 Minus
Blast to na_te.dros performed on 2014-11-26 17:01:40 has no hits.

FMO10292.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:20 Download gff for FMO10292.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6201-RA 109..1100 1..1000 94   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:14:35 Download gff for FMO10292.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6201-RA 107..1098 1..1000 94   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:34 Download gff for FMO10292.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6201-RA 107..1098 1..1000 94   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:34 Download gff for FMO10292.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 11112493..11112953 1..465 98   Minus
2L 11112026..11112431 466..869 92 <- Minus
2L 11111824..11111913 912..1000 98 == Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:14:35 Download gff for FMO10292.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 11112493..11112953 1..465 98   Minus
arm_2L 11112026..11112431 466..869 92 <- Minus
arm_2L 11111824..11111913 912..1000 98 == Minus